| Variant ID: vg0220869460 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20869460 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, C: 0.08, others allele: 0.00, population size: 236. )
TTCTCTAGAAAAAAAATACATTACAAAAGATATCTACTCGATGTGGACGAGGAATCAGGGAGTCATGTTTTGAACTTGCAAACAAGAGGAAGAAAATCTG[G/C]
CATGTTCTAATAAAAGAACTTAAGAGCTTAAGTGTCTTTCGTATTGTTTATGATTGTTTAGGCACAATTGGTTGCCAGGAGATCAAAATGAAAAAAAAAG
CTTTTTTTTTCATTTTGATCTCCTGGCAACCAATTGTGCCTAAACAATCATAAACAATACGAAAGACACTTAAGCTCTTAAGTTCTTTTATTAGAACATG[C/G]
CAGATTTTCTTCCTCTTGTTTGCAAGTTCAAAACATGACTCCCTGATTCCTCGTCCACATCGAGTAGATATCTTTTGTAATGTATTTTTTTTCTAGAGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.00% | 42.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 91.80% | 8.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.90% | 62.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.10% | 8.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.00% | 13.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 64.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220869460 | G -> C | LOC_Os02g34800.1 | upstream_gene_variant ; 4122.0bp to feature; MODIFIER | silent_mutation | Average:54.207; most accessible tissue: Callus, score: 76.487 | N | N | N | N |
| vg0220869460 | G -> C | LOC_Os02g34820.1 | downstream_gene_variant ; 4275.0bp to feature; MODIFIER | silent_mutation | Average:54.207; most accessible tissue: Callus, score: 76.487 | N | N | N | N |
| vg0220869460 | G -> C | LOC_Os02g34810.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.207; most accessible tissue: Callus, score: 76.487 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220869460 | NA | 1.34E-30 | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 3.72E-30 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 8.82E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 1.75E-35 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 1.85E-66 | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 7.90E-10 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 9.45E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 1.62E-11 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 2.48E-34 | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220869460 | NA | 1.49E-21 | mr1416 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/