RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0220869217:

Variant ID: vg0220869217 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20869217
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.08, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAAGTTGGACTCTGTAAATATCCAACCTACAATTGCACTGGTTTTTACATGAAGAACAGCTAAGAAAAGCTGCCATAGTAAACCCCATTTCGTTGCAT[T/C]
GCAGAAGAAAGATTGATATGATGGACTACCTCAAACTCCCAGTGTTTGGATTACATTCGGTAAAAAGAAAAACTATCTGAACTATATTTCTGTCCTGAAG

Reverse complement sequence

CTTCAGGACAGAAATATAGTTCAGATAGTTTTTCTTTTTACCGAATGTAATCCAAACACTGGGAGTTTGAGGTAGTCCATCATATCAATCTTTCTTCTGC[A/G]
ATGCAACGAAATGGGGTTTACTATGGCAGCTTTTCTTAGCTGTTCTTCATGTAAAAACCAGTGCAATTGTAGGTTGGATATTTACAGAGTCCAACTTTAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	42.80%	0.06%	0.02%	NA
All Indica	2759	91.80%	8.00%	0.11%	0.04%	NA
All Japonica	1512	1.60%	98.40%	0.00%	0.00%	NA
Aus	269	37.90%	62.10%	0.00%	0.00%	NA
Indica I	595	97.50%	2.40%	0.17%	0.00%	NA
Indica II	465	95.70%	4.30%	0.00%	0.00%	NA
Indica III	913	91.10%	8.80%	0.11%	0.00%	NA
Indica Intermediate	786	86.10%	13.60%	0.13%	0.13%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	35.60%	64.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220869217	T -> DEL	N	N	silent_mutation	Average:57.355; most accessible tissue: Minghui63 flag leaf, score: 80.516	N	N	N	N
vg0220869217	T -> C	LOC_Os02g34800.1	upstream_gene_variant ; 3879.0bp to feature; MODIFIER	silent_mutation	Average:57.355; most accessible tissue: Minghui63 flag leaf, score: 80.516	N	N	N	N
vg0220869217	T -> C	LOC_Os02g34820.1	downstream_gene_variant ; 4518.0bp to feature; MODIFIER	silent_mutation	Average:57.355; most accessible tissue: Minghui63 flag leaf, score: 80.516	N	N	N	N
vg0220869217	T -> C	LOC_Os02g34810.1	intron_variant ; MODIFIER	silent_mutation	Average:57.355; most accessible tissue: Minghui63 flag leaf, score: 80.516	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220869217	NA	1.76E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	1.96E-25	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	2.27E-34	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	7.95E-14	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	3.83E-68	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	1.15E-09	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	5.59E-12	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	2.48E-34	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	2.82E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220869217	NA	1.39E-42	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 42 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0220869217:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact