Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0220269450:

Variant ID: vg0220269450 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20269450
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCATACTACTCCCAATGGTCCTAAATTGATTGGCCATTTTATAACTACTTCCTCCGTTTCACAATGTAAGGCATTCTAGCATTTCCCACATTCATATT[G/A]
ATGTTAATGAATCTAGATAGATATATATGTCTAGATTCATTAACATTAATATGAATATGAGAAATGCTAGAATGACTTACATTGTGAAACGGAGGGAGTA

Reverse complement sequence

TACTCCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCTCATATTCATATTAATGTTAATGAATCTAGACATATATATCTATCTAGATTCATTAACAT[C/T]
AATATGAATGTGGGAAATGCTAGAATGCCTTACATTGTGAAACGGAGGAAGTAGTTATAAAATGGCCAATCAATTTAGGACCATTGGGAGTAGTATGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 8.80% 15.13% 20.44% NA
All Indica  2759 46.50% 0.90% 23.45% 29.10% NA
All Japonica  1512 81.00% 17.50% 0.60% 0.93% NA
Aus  269 27.10% 5.60% 17.10% 50.19% NA
Indica I  595 35.80% 0.70% 36.13% 27.39% NA
Indica II  465 37.40% 0.90% 24.73% 36.99% NA
Indica III  913 61.80% 1.20% 13.25% 23.77% NA
Indica Intermediate  786 42.20% 0.90% 24.94% 31.93% NA
Temperate Japonica  767 79.80% 19.20% 0.39% 0.65% NA
Tropical Japonica  504 79.80% 19.00% 0.79% 0.40% NA
Japonica Intermediate  241 87.60% 8.70% 0.83% 2.90% NA
VI/Aromatic  96 4.20% 93.80% 2.08% 0.00% NA
Intermediate  90 51.10% 21.10% 12.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220269450 G -> A LOC_Os02g33980-LOC_Os02g33990 intergenic_region ; MODIFIER silent_mutation Average:26.488; most accessible tissue: Callus, score: 70.033 N N N N
vg0220269450 G -> DEL N N silent_mutation Average:26.488; most accessible tissue: Callus, score: 70.033 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220269450 1.70E-09 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 2.37E-07 3.64E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 1.90E-08 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 1.79E-06 1.63E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 9.79E-08 4.19E-13 mr1585 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 1.02E-06 5.60E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 2.66E-09 NA mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 6.75E-07 1.27E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 NA 5.10E-08 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 4.14E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 NA 1.63E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 1.71E-06 7.61E-12 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450 NA 4.05E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251