Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219343219:

Variant ID: vg0219343219 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19343219
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGCCTACGCCGTCTGCGTGCCGCCCAGCGGCCGGTGCGCGTGCCTGGCCAACGCGACGGACGGCTCGGGATGCGCCGCCGCAAACGTCGGCGGCGGCG[G/A]
CGGCCTCTGCGGCCGCACGGGCGGCGAGGTGGGCGGGCTGTACTGGGAGGTGCGGAGGCAGCGCGTGGAGCCGGCGAACAAGGAATTCCTGCCGTTCGAG

Reverse complement sequence

CTCGAACGGCAGGAATTCCTTGTTCGCCGGCTCCACGCGCTGCCTCCGCACCTCCCAGTACAGCCCGCCCACCTCGCCGCCCGTGCGGCCGCAGAGGCCG[C/T]
CGCCGCCGCCGACGTTTGCGGCGGCGCATCCCGAGCCGTCCGTCGCGTTGGCCAGGCACGCGCACCGGCCGCTGGGCGGCACGCAGACGGCGTAGGCGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 12.40% 4.87% 1.23% NA
All Indica  2759 76.40% 20.70% 2.43% 0.43% NA
All Japonica  1512 86.80% 0.10% 10.12% 2.98% NA
Aus  269 96.70% 1.90% 1.49% 0.00% NA
Indica I  595 85.40% 7.60% 7.06% 0.00% NA
Indica II  465 87.30% 8.80% 1.94% 1.94% NA
Indica III  913 64.80% 34.90% 0.11% 0.11% NA
Indica Intermediate  786 76.60% 21.20% 1.91% 0.25% NA
Temperate Japonica  767 76.50% 0.00% 18.25% 5.22% NA
Tropical Japonica  504 98.60% 0.40% 0.60% 0.40% NA
Japonica Intermediate  241 94.60% 0.00% 4.15% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 87.80% 6.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219343219 G -> A LOC_Os02g32620.1 missense_variant ; p.Gly351Asp; MODERATE nonsynonymous_codon ; G351D Average:93.9; most accessible tissue: Zhenshan97 root, score: 96.529 unknown unknown TOLERATED 0.07
vg0219343219 G -> DEL LOC_Os02g32620.1 N frameshift_variant Average:93.9; most accessible tissue: Zhenshan97 root, score: 96.529 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0219343219 G A 0.0 -0.01 -0.02 -0.01 -0.01 -0.02