Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219342098:

Variant ID: vg0219342098 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 19342098
Reference Allele: CAlternative Allele: CTTCTTCTTCTTCTTCTTCTT,CTTCTTCTTCTTCTTCTT,CTTCTTCTTCTTCTT,CTTCTTCTT,CTTCTTCTTCTT,CTTCTTCTTCTTCTTCTTCTTCTT
Primary Allele: CSecondary Allele: CTTCTTCTTCTTCTTCTTCT T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCTTTGTCTTCTCCTGCTCCTCCCGATCCCAATCCGCCATTGGTGGGCGCCAAGCTCAGCTCGTTGCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT[C/CTTCTTCTTCTTCTTCTTCTT,CTTCTTCTTCTTCTTCTT,CTTCTTCTTCTTCTT,CTTCTTCTT,CTTCTTCTTCTT,CTTCTTCTTCTTCTTCTTCTTCTT]
CTCACTCGCTGCCCACTCATTGGGAAAAATCCGAGCTCGGATTGAGGTTTGTTGGTAAGACGGACAGCCATGGAAGCGGTGAGGTGTTTTGTGGTGTTGT

Reverse complement sequence

ACAACACCACAAAACACCTCACCGCTTCCATGGCTGTCCGTCTTACCAACAAACCTCAATCCGAGCTCGGATTTTTCCCAATGAGTGGGCAGCGAGTGAG[G/AAGAAGAAGAAGAAGAAGAAG,AAGAAGAAGAAGAAGAAG,AAGAAGAAGAAGAAG,AAGAAGAAG,AAGAAGAAGAAG,AAGAAGAAGAAGAAGAAGAAGAAG]
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAGCAACGAGCTGAGCTTGGCGCCCACCAATGGCGGATTGGGATCGGGAGGAGCAGGAGAAGACAAAGAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CTTCTTCTTCTTCTTCTTCT T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 0.10% 2.33% 0.99% CTTCTTCTTCTT: 0.06%; CTTCTTCTTCTTCTTCTT: 0.02%; CTTCTTCTTCTTCTT: 0.02%; CTTCTTCTTCTTCTTCTTCTTCTT: 0.02%
All Indica  2759 94.00% 0.10% 3.95% 1.70% CTTCTTCTTCTT: 0.11%; CTTCTTCTTCTTCTTCTT: 0.04%; CTTCTTCTTCTTCTT: 0.04%; CTTCTTCTTCTTCTTCTTCTTCTT: 0.04%
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.30% 0.20% 6.22% 3.03% CTTCTTCTTCTT: 0.17%; CTTCTTCTTCTTCTT: 0.17%
Indica II  465 94.00% 0.20% 4.95% 0.43% CTTCTTCTTCTTCTTCTT: 0.22%; CTTCTTCTTCTTCTTCTTCTTCTT: 0.22%
Indica III  913 94.90% 0.10% 3.18% 1.75% CTTCTTCTTCTT: 0.11%
Indica Intermediate  786 95.80% 0.10% 2.54% 1.40% CTTCTTCTTCTT: 0.13%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219342098 C -> CTTCTTCTTCTTCTTCTTCTTCTT LOC_Os02g32620.1 5_prime_UTR_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTTCTTCTTCTTCTT LOC_Os02g32630.1 upstream_gene_variant ; 3638.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> DEL N N silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTTCTTCTT LOC_Os02g32620.1 5_prime_UTR_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTTCTTCTT LOC_Os02g32630.1 upstream_gene_variant ; 3638.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTTCTTCTTCTT LOC_Os02g32620.1 5_prime_UTR_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTTCTTCTTCTT LOC_Os02g32630.1 upstream_gene_variant ; 3638.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTT LOC_Os02g32620.1 5_prime_UTR_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTT LOC_Os02g32630.1 upstream_gene_variant ; 3638.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTTCTT LOC_Os02g32620.1 5_prime_UTR_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTTCTTCTT LOC_Os02g32630.1 upstream_gene_variant ; 3638.0bp to feature; MODIFIER silent_mutation Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTT LOC_Os02g32620.1 5_prime_UTR_variant ; 69.0bp to feature; MODIFIER N Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N
vg0219342098 C -> CTTCTTCTT LOC_Os02g32630.1 upstream_gene_variant ; 3638.0bp to feature; MODIFIER N Average:90.072; most accessible tissue: Minghui63 root, score: 97.617 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0219342098 C CTTCT* -0.15 -0.2 -0.21 -0.34 -0.32 -0.28