Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219342072:

Variant ID: vg0219342072 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19342072
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGACAGATAAATATTCCCCCCTCAAGCTCTTTGTCTTCTCCTGCTCCTCCCGATCCCAATCCGCCATTGGTGGGCGCCAAGCTCAGCTCGTTGCTCTTC[T/G]
TCTTCTTCTTCTTCTTCTTCTTCTTCCTCACTCGCTGCCCACTCATTGGGAAAAATCCGAGCTCGGATTGAGGTTTGTTGGTAAGACGGACAGCCATGGA

Reverse complement sequence

TCCATGGCTGTCCGTCTTACCAACAAACCTCAATCCGAGCTCGGATTTTTCCCAATGAGTGGGCAGCGAGTGAGGAAGAAGAAGAAGAAGAAGAAGAAGA[A/C]
GAAGAGCAACGAGCTGAGCTTGGCGCCCACCAATGGCGGATTGGGATCGGGAGGAGCAGGAGAAGACAAAGAGCTTGAGGGGGGAATATTTATCTGTCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.40% 1.30% 10.43% 18.83% NA
All Indica  2759 49.30% 2.10% 17.14% 31.42% NA
All Japonica  1512 98.30% 0.10% 0.53% 0.99% NA
Aus  269 98.90% 0.00% 0.74% 0.37% NA
Indica I  595 55.50% 1.50% 7.73% 35.29% NA
Indica II  465 37.60% 3.70% 15.70% 43.01% NA
Indica III  913 47.90% 1.40% 25.63% 25.08% NA
Indica Intermediate  786 53.30% 2.40% 15.27% 29.01% NA
Temperate Japonica  767 98.60% 0.10% 0.65% 0.65% NA
Tropical Japonica  504 99.00% 0.00% 0.40% 0.60% NA
Japonica Intermediate  241 96.30% 0.40% 0.41% 2.90% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 3.30% 11.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219342072 T -> G LOC_Os02g32620.1 5_prime_UTR_variant ; 96.0bp to feature; MODIFIER silent_mutation Average:92.26; most accessible tissue: Minghui63 root, score: 98.028 N N N N
vg0219342072 T -> G LOC_Os02g32630.1 upstream_gene_variant ; 3665.0bp to feature; MODIFIER silent_mutation Average:92.26; most accessible tissue: Minghui63 root, score: 98.028 N N N N
vg0219342072 T -> DEL N N silent_mutation Average:92.26; most accessible tissue: Minghui63 root, score: 98.028 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0219342072 T G 0.01 -0.01 -0.01 -0.01 0.0 -0.01