Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219100616:

Variant ID: vg0219100616 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19100616
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

GGGAACAATTGATTTGCAAAGATAGCATATTATCATTCTAAAGTCACAACACAATTAATGCCATTAAACCCCCTTTGCAAGGAAAAATGTAAATACCAAA[A/G]
GAAATTTTGTGAAGTTCTAGTAAGCTGCTTAGGTTAGCATAAACCTAAACCATGACCCCAACACATAATTAGTTTTGACTTGCAACATAGAAGTGAGACA

Reverse complement sequence

TGTCTCACTTCTATGTTGCAAGTCAAAACTAATTATGTGTTGGGGTCATGGTTTAGGTTTATGCTAACCTAAGCAGCTTACTAGAACTTCACAAAATTTC[T/C]
TTTGGTATTTACATTTTTCCTTGCAAAGGGGGTTTAATGGCATTAATTGTGTTGTGACTTTAGAATGATAATATGCTATCTTTGCAAATCAATTGTTCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	47.00%	0.21%	0.28%	NA
All Indica	2759	84.10%	15.30%	0.25%	0.36%	NA
All Japonica	1512	4.20%	95.80%	0.00%	0.07%	NA
Aus	269	17.10%	82.90%	0.00%	0.00%	NA
Indica I	595	69.10%	30.40%	0.17%	0.34%	NA
Indica II	465	91.00%	8.60%	0.22%	0.22%	NA
Indica III	913	93.80%	6.00%	0.11%	0.11%	NA
Indica Intermediate	786	80.00%	18.70%	0.51%	0.76%	NA
Temperate Japonica	767	1.80%	98.00%	0.00%	0.13%	NA
Tropical Japonica	504	7.10%	92.90%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	38.90%	55.60%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219100616	A -> G	LOC_Os02g32340.1	upstream_gene_variant ; 3200.0bp to feature; MODIFIER	silent_mutation	Average:63.299; most accessible tissue: Minghui63 flower, score: 77.024	N	N	N	N
vg0219100616	A -> G	LOC_Os02g32350.1	intron_variant ; MODIFIER	silent_mutation	Average:63.299; most accessible tissue: Minghui63 flower, score: 77.024	N	N	N	N
vg0219100616	A -> G	LOC_Os02g32350.2	intron_variant ; MODIFIER	silent_mutation	Average:63.299; most accessible tissue: Minghui63 flower, score: 77.024	N	N	N	N
vg0219100616	A -> DEL	N	N	silent_mutation	Average:63.299; most accessible tissue: Minghui63 flower, score: 77.024	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219100616	NA	4.48E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219100616	NA	2.82E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219100616	NA	2.27E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251