| Variant ID: vg0219100123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19100123 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 277. )
TATACTTCCTAATTATTTTTGAAAACCAGAAACTAGAAACGGGAATGTTCAACTTAACAAGTCCAGGACTAAAATGGTTCATAAGAATAAAACATGAGTT[T/C]
GTGCAATTTCCTAGAGATGATCCCATGGATGATGGATCATGTAATTAAAACAACAGGATGAAATCACTAGCTGTTTAGGCAATCAACAGCAGAACATTAG
CTAATGTTCTGCTGTTGATTGCCTAAACAGCTAGTGATTTCATCCTGTTGTTTTAATTACATGATCCATCATCCATGGGATCATCTCTAGGAAATTGCAC[A/G]
AACTCATGTTTTATTCTTATGAACCATTTTAGTCCTGGACTTGTTAAGTTGAACATTCCCGTTTCTAGTTTCTGGTTTTCAAAAATAATTAGGAAGTATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.80% | 44.60% | 0.28% | 0.25% | NA |
| All Indica | 2759 | 26.50% | 72.80% | 0.36% | 0.33% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 84.00% | 16.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 30.30% | 69.20% | 0.17% | 0.34% | NA |
| Indica II | 465 | 10.10% | 89.70% | 0.00% | 0.22% | NA |
| Indica III | 913 | 30.70% | 68.80% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 28.50% | 70.20% | 0.64% | 0.64% | NA |
| Temperate Japonica | 767 | 98.20% | 1.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 28.90% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219100123 | T -> DEL | N | N | silent_mutation | Average:62.833; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0219100123 | T -> C | LOC_Os02g32340.1 | upstream_gene_variant ; 2707.0bp to feature; MODIFIER | silent_mutation | Average:62.833; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0219100123 | T -> C | LOC_Os02g32350.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.833; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0219100123 | T -> C | LOC_Os02g32350.2 | intron_variant ; MODIFIER | silent_mutation | Average:62.833; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219100123 | NA | 1.08E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219100123 | NA | 4.01E-13 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219100123 | NA | 2.38E-16 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219100123 | NA | 5.27E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219100123 | NA | 6.46E-21 | mr1627_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219100123 | NA | 4.57E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |