Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219100123:

Variant ID: vg0219100123 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19100123
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TATACTTCCTAATTATTTTTGAAAACCAGAAACTAGAAACGGGAATGTTCAACTTAACAAGTCCAGGACTAAAATGGTTCATAAGAATAAAACATGAGTT[T/C]
GTGCAATTTCCTAGAGATGATCCCATGGATGATGGATCATGTAATTAAAACAACAGGATGAAATCACTAGCTGTTTAGGCAATCAACAGCAGAACATTAG

Reverse complement sequence

CTAATGTTCTGCTGTTGATTGCCTAAACAGCTAGTGATTTCATCCTGTTGTTTTAATTACATGATCCATCATCCATGGGATCATCTCTAGGAAATTGCAC[A/G]
AACTCATGTTTTATTCTTATGAACCATTTTAGTCCTGGACTTGTTAAGTTGAACATTCCCGTTTCTAGTTTCTGGTTTTCAAAAATAATTAGGAAGTATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.80%	44.60%	0.28%	0.25%	NA
All Indica	2759	26.50%	72.80%	0.36%	0.33%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.07%	NA
Aus	269	84.00%	16.00%	0.00%	0.00%	NA
Indica I	595	30.30%	69.20%	0.17%	0.34%	NA
Indica II	465	10.10%	89.70%	0.00%	0.22%	NA
Indica III	913	30.70%	68.80%	0.44%	0.11%	NA
Indica Intermediate	786	28.50%	70.20%	0.64%	0.64%	NA
Temperate Japonica	767	98.20%	1.70%	0.00%	0.13%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	28.90%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219100123	T -> DEL	N	N	silent_mutation	Average:62.833; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0219100123	T -> C	LOC_Os02g32340.1	upstream_gene_variant ; 2707.0bp to feature; MODIFIER	silent_mutation	Average:62.833; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0219100123	T -> C	LOC_Os02g32350.1	intron_variant ; MODIFIER	silent_mutation	Average:62.833; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0219100123	T -> C	LOC_Os02g32350.2	intron_variant ; MODIFIER	silent_mutation	Average:62.833; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219100123	NA	1.08E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219100123	NA	4.01E-13	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219100123	NA	2.38E-16	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219100123	NA	5.27E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219100123	NA	6.46E-21	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219100123	NA	4.57E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251