\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218843921:

Variant ID: vg0218843921 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18843921
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGCTAATCACGGACTAATTAGGCTTAAAAGATTAGTCTCGTGATTTCCTCCATAACTGTGCAATTAGTTTTTCTTTTTATCTATATTTAATGCTTCAT[G/A]
CATATGTCCAAAGATTCGATGTGATGTTTTTGGGAAAAATTTTTGGGAGGGCCTGTTTAGTTCGCGAAAAAGGAAATTTTTGGGTGTCACATCGGACGTT

Reverse complement sequence

AACGTCCGATGTGACACCCAAAAATTTCCTTTTTCGCGAACTAAACAGGCCCTCCCAAAAATTTTTCCCAAAAACATCACATCGAATCTTTGGACATATG[C/T]
ATGAAGCATTAAATATAGATAAAAAGAAAAACTAATTGCACAGTTATGGAGGAAATCACGAGACTAATCTTTTAAGCCTAATTAGTCCGTGATTAGCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.00% 0.42% 0.00% NA
All Indica  2759 97.10% 2.90% 0.04% 0.00% NA
All Japonica  1512 65.70% 33.30% 1.06% 0.00% NA
Aus  269 93.70% 5.60% 0.74% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 95.20% 4.60% 0.26% 0.00% NA
Tropical Japonica  504 23.00% 74.80% 2.18% 0.00% NA
Japonica Intermediate  241 61.00% 37.80% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218843921 G -> A LOC_Os02g31890.1 upstream_gene_variant ; 1502.0bp to feature; MODIFIER silent_mutation Average:44.738; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0218843921 G -> A LOC_Os02g31910.1 downstream_gene_variant ; 1338.0bp to feature; MODIFIER silent_mutation Average:44.738; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0218843921 G -> A LOC_Os02g31910.2 downstream_gene_variant ; 1631.0bp to feature; MODIFIER silent_mutation Average:44.738; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0218843921 G -> A LOC_Os02g31890-LOC_Os02g31910 intergenic_region ; MODIFIER silent_mutation Average:44.738; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218843921 NA 2.77E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 2.52E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 3.51E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 1.87E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 4.46E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 9.79E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 7.32E-09 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 5.53E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 4.15E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 6.52E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 2.42E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 1.59E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 3.63E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 1.38E-12 mr1696_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 3.23E-10 mr1696_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 7.98E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 3.67E-12 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 4.71E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 1.04E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 2.80E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 2.27E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 3.91E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 1.11E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 4.62E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 2.33E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 1.53E-11 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218843921 NA 5.73E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251