\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217615900:

Variant ID: vg0217615900 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17615900
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATATAGTATTTGCACCTCACGTCGCTTGGCGTTAAGAACGGCTAGGTACCAGTGTGTATCTTTAATATTAATTAGGAGGAAAATCTGCAGATGTTCAACA[G/C]
TAAGATAGAGTCATAAATTGAATTAGCCATTACATAGATAGCTTAAATAAGTATTACCATGTCAAATGCTAGATAGTCGCGTGCCATATCTCTAATCCAT

Reverse complement sequence

ATGGATTAGAGATATGGCACGCGACTATCTAGCATTTGACATGGTAATACTTATTTAAGCTATCTATGTAATGGCTAATTCAATTTATGACTCTATCTTA[C/G]
TGTTGAACATCTGCAGATTTTCCTCCTAATTAATATTAAAGATACACACTGGTACCTAGCCGTTCTTAACGCCAAGCGACGTGAGGTGCAAATACTATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.50% 2.00% 47.00% 4.46% NA
All Indica  2759 19.20% 3.20% 70.06% 7.58% NA
All Japonica  1512 99.60% 0.00% 0.33% 0.07% NA
Aus  269 14.50% 2.20% 83.27% 0.00% NA
Indica I  595 14.60% 2.00% 78.15% 5.21% NA
Indica II  465 26.70% 3.90% 49.89% 19.57% NA
Indica III  913 20.90% 3.00% 72.51% 3.61% NA
Indica Intermediate  786 16.20% 3.90% 73.03% 6.87% NA
Temperate Japonica  767 99.60% 0.00% 0.26% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 62.50% 0.00% 37.50% 0.00% NA
Intermediate  90 71.10% 2.20% 25.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217615900 G -> DEL N N silent_mutation Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0217615900 G -> C LOC_Os02g29600.1 upstream_gene_variant ; 1710.0bp to feature; MODIFIER silent_mutation Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0217615900 G -> C LOC_Os02g29620.1 upstream_gene_variant ; 1841.0bp to feature; MODIFIER silent_mutation Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0217615900 G -> C LOC_Os02g29630.1 downstream_gene_variant ; 4777.0bp to feature; MODIFIER silent_mutation Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0217615900 G -> C LOC_Os02g29610.1 intron_variant ; MODIFIER silent_mutation Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217615900 5.95E-06 NA mr1914 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217615900 NA 2.82E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217615900 NA 7.00E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251