\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217327456:

Variant ID: vg0217327456 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17327456
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTTTCCATTAGTTGATCGTTAATATTTTATTAAGAAATCCATTTTTACCCTTTGGTATTAAAGAAACAAATAAATTTATTTATGGAATATAGAAGTCT[G/T]
TTTAATGAGACTTCTAATAACAAATGTCTTATAAATTTGTTAGTAAAATAAATAGTCAAACATGTGTAAAAAAAATCAATAGTGTCATCAATTAAAAATT

Reverse complement sequence

AATTTTTAATTGATGACACTATTGATTTTTTTTACACATGTTTGACTATTTATTTTACTAACAAATTTATAAGACATTTGTTATTAGAAGTCTCATTAAA[C/A]
AGACTTCTATATTCCATAAATAAATTTATTTGTTTCTTTAATACCAAAGGGTAAAAATGGATTTCTTAATAAAATATTAACGATCAACTAATGGAAAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 15.50% 0.04% 0.00% NA
All Indica  2759 77.10% 22.80% 0.07% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 92.30% 7.70% 0.00% 0.00% NA
Indica III  913 52.80% 47.00% 0.22% 0.00% NA
Indica Intermediate  786 81.40% 18.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217327456 G -> T LOC_Os02g29210.1 downstream_gene_variant ; 109.0bp to feature; MODIFIER silent_mutation Average:45.498; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0217327456 G -> T LOC_Os02g29210.3 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:45.498; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0217327456 G -> T LOC_Os02g29210.2 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:45.498; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0217327456 G -> T LOC_Os02g29210.4 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:45.498; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0217327456 G -> T LOC_Os02g29200-LOC_Os02g29210 intergenic_region ; MODIFIER silent_mutation Average:45.498; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217327456 7.12E-06 NA mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 3.60E-07 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.50E-10 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 1.97E-07 3.24E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 1.25E-06 NA mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 4.21E-08 NA mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 3.23E-07 1.76E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 5.02E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 7.09E-09 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 6.75E-06 NA mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 9.70E-06 2.24E-08 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 1.02E-08 NA mr1423 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 9.28E-06 5.97E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 7.81E-08 NA mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 5.98E-06 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 1.78E-06 NA mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 6.54E-06 NA mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 5.65E-06 NA mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 3.75E-07 NA mr1109_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 4.29E-06 NA mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 5.10E-08 NA mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 5.83E-07 NA mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.35E-07 NA mr1251_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.40E-06 NA mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.14E-08 NA mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.54E-06 2.15E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 3.93E-09 NA mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.02E-07 7.79E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 5.21E-09 NA mr1257_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 4.55E-07 NA mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.56E-06 NA mr1423_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.73E-07 NA mr1435_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.87E-06 NA mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217327456 2.83E-06 NA mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251