Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217137640:

Variant ID: vg0217137640 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17137640
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.22, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AACCGGTTCAGATCTTCTTGCACCGTTGTGTTTCCTTGTCGCAGCCTTCTGAACTCGTTCTTCTTCATGCGCATCACTGCAGCAGGCACGAAGTTCTCAC[G/A]
GAAAGCTGCAGTGAATTCTTCCCAAGTGGGTTCTCCAGCTTCTTCTTCCCGAGCTTCCTTGTAAGTATCCCACCAATCGCCAGCTGGTCCCTCTAGTTGG

Reverse complement sequence

CCAACTAGAGGGACCAGCTGGCGATTGGTGGGATACTTACAAGGAAGCTCGGGAAGAAGAAGCTGGAGAACCCACTTGGGAAGAATTCACTGCAGCTTTC[C/T]
GTGAGAACTTCGTGCCTGCTGCAGTGATGCGCATGAAGAAGAACGAGTTCAGAAGGCTGCGACAAGGAAACACAACGGTGCAAGAAGATCTGAACCGGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	22.90%	13.48%	0.30%	NA
All Indica	2759	50.70%	28.60%	20.22%	0.51%	NA
All Japonica	1512	96.10%	2.40%	1.46%	0.00%	NA
Aus	269	19.00%	70.30%	10.78%	0.00%	NA
Indica I	595	50.10%	31.10%	18.66%	0.17%	NA
Indica II	465	47.50%	35.90%	16.34%	0.22%	NA
Indica III	913	53.90%	21.70%	23.66%	0.77%	NA
Indica Intermediate	786	49.40%	30.30%	19.72%	0.64%	NA
Temperate Japonica	767	99.10%	0.70%	0.26%	0.00%	NA
Tropical Japonica	504	91.10%	5.60%	3.37%	0.00%	NA
Japonica Intermediate	241	97.10%	1.70%	1.24%	0.00%	NA
VI/Aromatic	96	35.40%	46.90%	17.71%	0.00%	NA
Intermediate	90	64.40%	23.30%	12.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217137640	G -> A	LOC_Os02g28960.1	missense_variant ; p.Arg404Cys; MODERATE	nonsynonymous_codon ; R404C	Average:48.695; most accessible tissue: Minghui63 flag leaf, score: 72.472	probably damaging	3.239	DELETERIOUS	0.01
vg0217137640	G -> DEL	LOC_Os02g28960.1	N	frameshift_variant	Average:48.695; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217137640	NA	2.10E-06	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	3.00E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	3.11E-39	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	4.78E-06	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.41E-27	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	3.99E-07	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	7.79E-20	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	9.66E-19	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	2.51E-33	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	7.94E-07	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	5.99E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	2.95E-51	mr1599	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	4.72E-08	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	1.79E-06	1.52E-50	mr1089_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	4.31E-10	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	9.08E-07	6.33E-53	mr1093_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	2.90E-10	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	9.21E-06	NA	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	2.61E-10	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.68E-07	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	4.53E-06	1.63E-56	mr1235_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	8.61E-11	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.48E-42	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	3.28E-07	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	6.28E-13	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	2.42E-06	4.48E-43	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	6.44E-11	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.16E-20	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	3.16E-06	1.29E-24	mr1255_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.52E-08	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	6.94E-08	1.36E-43	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.98E-10	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	9.94E-14	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.01E-11	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	3.99E-06	2.48E-36	mr1423_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	2.04E-08	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	3.54E-06	6.97E-43	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.08E-10	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.57E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	3.12E-07	5.80E-65	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.02E-11	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217137640	NA	1.10E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251