\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216761078:

Variant ID: vg0216761078 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16761078
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


TGCACAAGACTTGCAATTCAAGACGTATTCCATTGTTCAAGTTGTGAGTAAGTGTAGCTTGGAGTTCTAGGTGGATGTTCAACCTTAATCGGTCTCCATC[G/A]
AACCGCTGGTATATTAACTGTACATTGGAAAAAGGCAAATCTTAGTGGGATTTTGAGATTTGGTGGGGGATTGTTGGAATTAATATATGGGCTAAGGCCC

Reverse complement sequence

GGGCCTTAGCCCATATATTAATTCCAACAATCCCCCACCAAATCTCAAAATCCCACTAAGATTTGCCTTTTTCCAATGTACAGTTAATATACCAGCGGTT[C/T]
GATGGAGACCGATTAAGGTTGAACATCCACCTAGAACTCCAAGCTACACTTACTCACAACTTGAACAATGGAATACGTCTTGAATTGCAAGTCTTGTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 9.60% 2.45% 0.00% NA
All Indica  2759 80.50% 16.10% 3.41% 0.00% NA
All Japonica  1512 99.50% 0.20% 0.26% 0.00% NA
Aus  269 94.10% 1.10% 4.83% 0.00% NA
Indica I  595 71.90% 18.00% 10.08% 0.00% NA
Indica II  465 92.00% 6.50% 1.51% 0.00% NA
Indica III  913 79.50% 20.20% 0.33% 0.00% NA
Indica Intermediate  786 81.40% 15.50% 3.05% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 87.80% 7.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216761078 G -> A LOC_Os02g28360.1 upstream_gene_variant ; 1318.0bp to feature; MODIFIER silent_mutation Average:41.821; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg0216761078 G -> A LOC_Os02g28350.1 downstream_gene_variant ; 633.0bp to feature; MODIFIER silent_mutation Average:41.821; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg0216761078 G -> A LOC_Os02g28370.1 downstream_gene_variant ; 4810.0bp to feature; MODIFIER silent_mutation Average:41.821; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg0216761078 G -> A LOC_Os02g28350-LOC_Os02g28360 intergenic_region ; MODIFIER silent_mutation Average:41.821; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216761078 2.32E-08 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 5.82E-07 1.26E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 8.23E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 4.45E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 4.15E-07 NA mr1251 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 4.72E-06 7.68E-09 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 5.09E-07 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 4.69E-06 8.46E-08 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 9.94E-07 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 4.25E-06 3.37E-09 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 4.72E-08 NA mr1423 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 4.59E-08 8.07E-10 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 1.95E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 2.99E-08 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 6.62E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 1.88E-09 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 2.64E-08 6.36E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 3.41E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 7.73E-08 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 2.48E-07 NA mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 4.79E-06 3.77E-10 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 4.95E-06 NA mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 1.21E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 1.13E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 2.80E-06 1.59E-08 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 1.28E-06 mr1409_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 8.17E-06 4.90E-08 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 NA 6.71E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 6.31E-06 2.83E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 1.49E-07 9.63E-12 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 3.52E-06 NA mr1599_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216761078 2.93E-06 8.94E-09 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251