RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216664283:

Variant ID: vg0216664283 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16664283
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GGGAGTTGAGGCGCGGAGGTAAGTCATGCCACGCGTGGCGACCGGTGGCGATAGTCTCTGAGTCGGTAATTCAGCCTGCAAGTGGGGCGGGTCGACCCGT[T/C]
AGGTCCGTGGCCCGAACCTAAATTTGTGGCACCAATAGGTTTTCGGGCCGGTCCATATTTTCTTAGGTAACAATGGGTCCATGAGTCAGTTGATCCTAGG

Reverse complement sequence

CCTAGGATCAACTGACTCATGGACCCATTGTTACCTAAGAAAATATGGACCGGCCCGAAAACCTATTGGTGCCACAAATTTAGGTTCGGGCCACGGACCT[A/G]
ACGGGTCGACCCGCCCCACTTGCAGGCTGAATTACCGACTCAGAGACTATCGCCACCGGTCGCCACGCGTGGCATGACTTACCTCCGCGCCTCAACTCCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.40%	14.40%	0.34%	24.88%	NA
All Indica	2759	56.30%	19.30%	0.47%	23.99%	NA
All Japonica	1512	75.50%	0.60%	0.20%	23.74%	NA
Aus	269	3.00%	48.00%	0.00%	49.07%	NA
Indica I	595	43.00%	23.20%	0.84%	32.94%	NA
Indica II	465	61.10%	29.00%	0.00%	9.89%	NA
Indica III	913	60.70%	13.30%	0.11%	25.96%	NA
Indica Intermediate	786	58.30%	17.60%	0.89%	23.28%	NA
Temperate Japonica	767	96.60%	0.00%	0.00%	3.39%	NA
Tropical Japonica	504	40.30%	1.40%	0.40%	57.94%	NA
Japonica Intermediate	241	81.70%	0.80%	0.41%	17.01%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	6.70%	0.00%	25.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216664283	T -> DEL	N	N	silent_mutation	Average:65.375; most accessible tissue: Minghui63 panicle, score: 95.966	N	N	N	N
vg0216664283	T -> C	LOC_Os02g28130.1	downstream_gene_variant ; 2788.0bp to feature; MODIFIER	silent_mutation	Average:65.375; most accessible tissue: Minghui63 panicle, score: 95.966	N	N	N	N
vg0216664283	T -> C	LOC_Os02g28140.1	intron_variant ; MODIFIER	silent_mutation	Average:65.375; most accessible tissue: Minghui63 panicle, score: 95.966	N	N	N	N

Showing 1 to 3 of 3 entries

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Show entries

Search:

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0216664283	T	C	0.1	0.12	0.11	0.1	0.09	0.09

Showing 1 to 1 of 1 entries

Previous1Next

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216664283	NA	3.93E-10	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	NA	1.36E-10	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	NA	2.54E-06	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	NA	6.78E-07	mr1253	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	NA	3.47E-07	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	NA	2.22E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	2.53E-18	3.20E-34	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	3.81E-18	2.34E-36	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	1.57E-06	2.37E-09	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216664283	NA	1.64E-06	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 62 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg0216664283:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Effects Predicted by Deep Convolutional Neural Networks

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact