\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216616099:

Variant ID: vg0216616099 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16616099
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGGAATTCATCCGCCTAGGAATGTTGCTAGCTTATTAGGTAATTGGCTAAGGGGGGTTCAACCTAAACTAAAAACTCAAGTCTTTGGAGGGGTCGCA[G/A]
CGTTGTGTTGGGCGGTATGGTTGTGCAGAAATAATGTAGTCTTTAATGGCTCCAACACTAATTTCTTGTTGCAGGTGATTTTCAGGGGGACTTTTTGGGC

Reverse complement sequence

GCCCAAAAAGTCCCCCTGAAAATCACCTGCAACAAGAAATTAGTGTTGGAGCCATTAAAGACTACATTATTTCTGCACAACCATACCGCCCAACACAACG[C/T]
TGCGACCCCTCCAAAGACTTGAGTTTTTAGTTTAGGTTGAACCCCCCTTAGCCAATTACCTAATAAGCTAGCAACATTCCTAGGCGGATGAATTCCAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 25.40% 0.61% 0.00% NA
All Indica  2759 75.10% 24.00% 0.91% 0.00% NA
All Japonica  1512 75.80% 24.10% 0.13% 0.00% NA
Aus  269 45.00% 54.60% 0.37% 0.00% NA
Indica I  595 67.40% 30.80% 1.85% 0.00% NA
Indica II  465 90.30% 9.50% 0.22% 0.00% NA
Indica III  913 72.00% 26.90% 1.10% 0.00% NA
Indica Intermediate  786 75.60% 24.00% 0.38% 0.00% NA
Temperate Japonica  767 96.30% 3.70% 0.00% 0.00% NA
Tropical Japonica  504 41.30% 58.30% 0.40% 0.00% NA
Japonica Intermediate  241 82.60% 17.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216616099 G -> A LOC_Os02g28040.1 upstream_gene_variant ; 3861.0bp to feature; MODIFIER silent_mutation Average:49.697; most accessible tissue: Minghui63 young leaf, score: 75.006 N N N N
vg0216616099 G -> A LOC_Os02g28074.1 upstream_gene_variant ; 1312.0bp to feature; MODIFIER silent_mutation Average:49.697; most accessible tissue: Minghui63 young leaf, score: 75.006 N N N N
vg0216616099 G -> A LOC_Os02g28074.2 upstream_gene_variant ; 1279.0bp to feature; MODIFIER silent_mutation Average:49.697; most accessible tissue: Minghui63 young leaf, score: 75.006 N N N N
vg0216616099 G -> A LOC_Os02g28074.3 upstream_gene_variant ; 1312.0bp to feature; MODIFIER silent_mutation Average:49.697; most accessible tissue: Minghui63 young leaf, score: 75.006 N N N N
vg0216616099 G -> A LOC_Os02g28050.1 intron_variant ; MODIFIER silent_mutation Average:49.697; most accessible tissue: Minghui63 young leaf, score: 75.006 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216616099 NA 4.08E-13 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 4.04E-14 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 2.06E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 4.09E-08 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.65E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.20E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.87E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 3.29E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 8.12E-10 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 4.74E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 2.04E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 6.37E-12 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 9.05E-09 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.53E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.02E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 2.85E-08 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.67E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 2.54E-12 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 3.19E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 8.81E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 3.58E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 8.16E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 2.40E-10 5.83E-19 mr1379_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 1.52E-06 3.19E-09 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 5.32E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 9.40E-07 9.00E-08 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.07E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.69E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 2.25E-06 2.16E-11 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 4.68E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 1.06E-09 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 2.84E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 2.90E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616099 NA 5.91E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251