RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0213362445:

Variant ID: vg0213362445 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 13362445
Reference Allele: CT	Alternative Allele: C
Primary Allele: CT	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGACAGCCAAAAGCAAGCTCAACATTGCAATGGGGAAATTGCGATTAGGGAAATCTTGCCCGTGATTGCAATTTCGGAACAAAATTTTCAAAATTTTGC[CT/C]
CCCCCCCCACCGGCAAGCATATATCTCACCCGAAATTTCTCCTTTTTTCATGTTTTTGTGAATTTGGTCAAAGTTTATTCTAAATCATTCAAAATTCGTC

Reverse complement sequence

GACGAATTTTGAATGATTTAGAATAAACTTTGACCAAATTCACAAAAACATGAAAAAAGGAGAAATTTCGGGTGAGATATATGCTTGCCGGTGGGGGGGG[AG/G]
GCAAAATTTTGAAAATTTTGTTCCGAAATTGCAATCACGGGCAAGATTTCCCTAATCGCAATTTCCCCATTGCAATGTTGAGCTTGCTTTTGGCTGTCAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of CT(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.50%	0.10%	1.46%	0.89%	NA
All Indica	2759	99.70%	0.10%	0.11%	0.00%	NA
All Japonica	1512	93.00%	0.00%	4.23%	2.78%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.70%	0.20%	0.11%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	98.00%	0.00%	1.30%	0.65%	NA
Tropical Japonica	504	86.30%	0.00%	8.13%	5.56%	NA
Japonica Intermediate	241	90.90%	0.00%	5.39%	3.73%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0213362445	CT -> DEL	N	N	silent_mutation	Average:47.293; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg0213362445	CT -> C	LOC_Os02g22374.4	upstream_gene_variant ; 669.0bp to feature; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg0213362445	CT -> C	LOC_Os02g22370.1	downstream_gene_variant ; 1794.0bp to feature; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg0213362445	CT -> C	LOC_Os02g22370.3	downstream_gene_variant ; 4194.0bp to feature; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg0213362445	CT -> C	LOC_Os02g22370.2	downstream_gene_variant ; 2640.0bp to feature; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg0213362445	CT -> C	LOC_Os02g22374.2	downstream_gene_variant ; 541.0bp to feature; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg0213362445	CT -> C	LOC_Os02g22374.1	intron_variant ; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg0213362445	CT -> C	LOC_Os02g22374.3	intron_variant ; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N

Showing 1 to 8 of 8 entries

Search for Variation information by Variation ID:

Detailed information for vg0213362445:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact