Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0212395942:

Variant ID: vg0212395942 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12395942
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCATTCATGATGAGCATATTAGTCATCTAGCGTTGTCCTTAATCCACCTTTAACTAACACACTACTACAGAAAAGAAGATAGGTGTCGGTTGGGAACC[G/A]
GTCATAGGTGCTGAATTTTCCAACCGACATGTAGTGAGGTCTCAAATGTGTCAGTTTAAAAACCTACAAATAACAAAAAAAAAGGAAAAAAAAAGCTGGC

Reverse complement sequence

GCCAGCTTTTTTTTTCCTTTTTTTTTGTTATTTGTAGGTTTTTAAACTGACACATTTGAGACCTCACTACATGTCGGTTGGAAAATTCAGCACCTATGAC[C/T]
GGTTCCCAACCGACACCTATCTTCTTTTCTGTAGTAGTGTGTTAGTTAAAGGTGGATTAAGGACAACGCTAGATGACTAATATGCTCATCATGAATGGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 30.60% 0.83% 0.00% NA
All Indica  2759 96.60% 3.00% 0.33% 0.00% NA
All Japonica  1512 22.30% 76.10% 1.59% 0.00% NA
Aus  269 68.80% 31.20% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 97.60% 2.10% 0.33% 0.00% NA
Indica Intermediate  786 93.30% 6.20% 0.51% 0.00% NA
Temperate Japonica  767 4.20% 95.40% 0.39% 0.00% NA
Tropical Japonica  504 52.20% 44.20% 3.57% 0.00% NA
Japonica Intermediate  241 17.40% 81.30% 1.24% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 55.60% 37.80% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212395942 G -> A LOC_Os02g20950.1 downstream_gene_variant ; 1699.0bp to feature; MODIFIER silent_mutation Average:68.425; most accessible tissue: Minghui63 young leaf, score: 80.234 N N N N
vg0212395942 G -> A LOC_Os02g20960.1 downstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:68.425; most accessible tissue: Minghui63 young leaf, score: 80.234 N N N N
vg0212395942 G -> A LOC_Os02g20970.1 downstream_gene_variant ; 2479.0bp to feature; MODIFIER silent_mutation Average:68.425; most accessible tissue: Minghui63 young leaf, score: 80.234 N N N N
vg0212395942 G -> A LOC_Os02g20950-LOC_Os02g20960 intergenic_region ; MODIFIER silent_mutation Average:68.425; most accessible tissue: Minghui63 young leaf, score: 80.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212395942 NA 3.54E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 1.27E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 3.31E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 2.45E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 1.87E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 9.75E-07 NA mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 2.58E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 5.06E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 5.27E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 2.43E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 6.05E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 6.93E-08 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 6.32E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 2.59E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 1.33E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 NA 1.29E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 5.39E-06 3.93E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 1.78E-09 NA mr1871_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212395942 1.09E-06 3.34E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251