\
| Variant ID: vg0209688142 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 9688142 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACCGATTTGTGACCGGTCTGACACTGGTCATATCGTCAGCAGAAAGCCATATTCCCACGTCGCGCCTGCTTCCGGCGGAAGTGGAGGTAGGTATGGGCC[G/A]
TCCCATCAGAAGGTCATTCAGACGGCAACCATACAAATCTCCGTCCATTTATGAAAAGATAGGATAAGTCCCCACACAAAAGAGAGAGATGGTGCATGTG
CACATGCACCATCTCTCTCTTTTGTGTGGGGACTTATCCTATCTTTTCATAAATGGACGGAGATTTGTATGGTTGCCGTCTGAATGACCTTCTGATGGGA[C/T]
GGCCCATACCTACCTCCACTTCCGCCGGAAGCAGGCGCGACGTGGGAATATGGCTTTCTGCTGACGATATGACCAGTGTCAGACCGGTCACAAATCGGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.80% | 0.50% | 2.16% | 23.53% | NA |
| All Indica | 2759 | 63.80% | 0.00% | 3.04% | 33.09% | NA |
| All Japonica | 1512 | 95.00% | 1.50% | 0.07% | 3.37% | NA |
| Aus | 269 | 48.70% | 0.00% | 5.58% | 45.72% | NA |
| Indica I | 595 | 70.40% | 0.20% | 0.67% | 28.74% | NA |
| Indica II | 465 | 56.60% | 0.00% | 5.59% | 37.85% | NA |
| Indica III | 913 | 63.60% | 0.00% | 3.50% | 32.86% | NA |
| Indica Intermediate | 786 | 63.40% | 0.00% | 2.80% | 33.84% | NA |
| Temperate Japonica | 767 | 91.40% | 2.50% | 0.13% | 6.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 1.04% | 7.29% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 1.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0209688142 | G -> A | LOC_Os02g16980.1 | upstream_gene_variant ; 3700.0bp to feature; MODIFIER | silent_mutation | Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| vg0209688142 | G -> A | LOC_Os02g16970.1 | downstream_gene_variant ; 968.0bp to feature; MODIFIER | silent_mutation | Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| vg0209688142 | G -> A | LOC_Os02g16970-LOC_Os02g16980 | intergenic_region ; MODIFIER | silent_mutation | Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| vg0209688142 | G -> DEL | N | N | silent_mutation | Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0209688142 | 1.13E-08 | 5.90E-11 | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209688142 | 3.40E-08 | 4.60E-09 | mr1550 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209688142 | 4.62E-06 | 7.60E-10 | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209688142 | 6.85E-06 | 6.85E-06 | mr1881 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209688142 | NA | 3.06E-06 | mr1896 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209688142 | NA | 1.99E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |