\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209688142:

Variant ID: vg0209688142 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9688142
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACCGATTTGTGACCGGTCTGACACTGGTCATATCGTCAGCAGAAAGCCATATTCCCACGTCGCGCCTGCTTCCGGCGGAAGTGGAGGTAGGTATGGGCC[G/A]
TCCCATCAGAAGGTCATTCAGACGGCAACCATACAAATCTCCGTCCATTTATGAAAAGATAGGATAAGTCCCCACACAAAAGAGAGAGATGGTGCATGTG

Reverse complement sequence

CACATGCACCATCTCTCTCTTTTGTGTGGGGACTTATCCTATCTTTTCATAAATGGACGGAGATTTGTATGGTTGCCGTCTGAATGACCTTCTGATGGGA[C/T]
GGCCCATACCTACCTCCACTTCCGCCGGAAGCAGGCGCGACGTGGGAATATGGCTTTCTGCTGACGATATGACCAGTGTCAGACCGGTCACAAATCGGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.80% 0.50% 2.16% 23.53% NA
All Indica  2759 63.80% 0.00% 3.04% 33.09% NA
All Japonica  1512 95.00% 1.50% 0.07% 3.37% NA
Aus  269 48.70% 0.00% 5.58% 45.72% NA
Indica I  595 70.40% 0.20% 0.67% 28.74% NA
Indica II  465 56.60% 0.00% 5.59% 37.85% NA
Indica III  913 63.60% 0.00% 3.50% 32.86% NA
Indica Intermediate  786 63.40% 0.00% 2.80% 33.84% NA
Temperate Japonica  767 91.40% 2.50% 0.13% 6.00% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 91.70% 0.00% 1.04% 7.29% NA
Intermediate  90 78.90% 0.00% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209688142 G -> A LOC_Os02g16980.1 upstream_gene_variant ; 3700.0bp to feature; MODIFIER silent_mutation Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N
vg0209688142 G -> A LOC_Os02g16970.1 downstream_gene_variant ; 968.0bp to feature; MODIFIER silent_mutation Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N
vg0209688142 G -> A LOC_Os02g16970-LOC_Os02g16980 intergenic_region ; MODIFIER silent_mutation Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N
vg0209688142 G -> DEL N N silent_mutation Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209688142 1.13E-08 5.90E-11 mr1549 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142 3.40E-08 4.60E-09 mr1550 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142 4.62E-06 7.60E-10 mr1757 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142 6.85E-06 6.85E-06 mr1881 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142 NA 3.06E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142 NA 1.99E-07 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251