Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209213128:

Variant ID: vg0209213128 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 9213128
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAGGTAAAAAAGTAACTAAGTTTACAAGTTACATTTTTAGTGTTTGTTCTATAGTTCAAAATTGTACTGATTTACTTCCAGCAAACACAAACTGTAC[A/T]
AACTACGCAAAATTGTAGTAACTTACTTGCTTCAAAACTGTACTGACTTCCTTATGTGTATTATTTTTGATATTCAGCTGGGTTGTGGATTTCTATGGAA

Reverse complement sequence

TTCCATAGAAATCCACAACCCAGCTGAATATCAAAAATAATACACATAAGGAAGTCAGTACAGTTTTGAAGCAAGTAAGTTACTACAATTTTGCGTAGTT[T/A]
GTACAGTTTGTGTTTGCTGGAAGTAAATCAGTACAATTTTGAACTATAGAACAAACACTAAAAATGTAACTTGTAAACTTAGTTACTTTTTTACCTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	5.50%	3.34%	7.96%	NA
All Indica	2759	78.30%	9.20%	5.18%	7.36%	NA
All Japonica	1512	98.90%	0.10%	0.33%	0.60%	NA
Aus	269	41.30%	0.40%	1.86%	56.51%	NA
Indica I	595	72.40%	14.80%	3.03%	9.75%	NA
Indica II	465	86.00%	4.30%	4.95%	4.73%	NA
Indica III	913	78.50%	8.70%	6.57%	6.24%	NA
Indica Intermediate	786	77.90%	8.40%	5.34%	8.40%	NA
Temperate Japonica	767	99.00%	0.10%	0.00%	0.91%	NA
Tropical Japonica	504	98.60%	0.20%	0.79%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	80.00%	4.40%	5.56%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209213128	A -> T	LOC_Os02g16200.1	upstream_gene_variant ; 2797.0bp to feature; MODIFIER	silent_mutation	Average:11.092; most accessible tissue: Minghui63 flower, score: 20.111	N	N	N	N
vg0209213128	A -> T	LOC_Os02g16220.1	downstream_gene_variant ; 2139.0bp to feature; MODIFIER	silent_mutation	Average:11.092; most accessible tissue: Minghui63 flower, score: 20.111	N	N	N	N
vg0209213128	A -> T	LOC_Os02g16210.1	intron_variant ; MODIFIER	silent_mutation	Average:11.092; most accessible tissue: Minghui63 flower, score: 20.111	N	N	N	N
vg0209213128	A -> DEL	N	N	silent_mutation	Average:11.092; most accessible tissue: Minghui63 flower, score: 20.111	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209213128	NA	1.65E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	2.22E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	1.43E-07	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	9.05E-08	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	1.97E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	8.15E-06	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	1.66E-07	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	3.66E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	2.08E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	9.52E-06	mr1567_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	6.64E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	2.68E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	4.82E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	4.81E-06	NA	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	5.03E-06	NA	mr1846_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	9.15E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	9.30E-06	mr1909_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	7.33E-06	9.51E-06	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128	NA	1.72E-06	mr1930_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251