\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209213128:

Variant ID: vg0209213128 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9213128
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGGTAAAAAAGTAACTAAGTTTACAAGTTACATTTTTAGTGTTTGTTCTATAGTTCAAAATTGTACTGATTTACTTCCAGCAAACACAAACTGTAC[A/T]
AACTACGCAAAATTGTAGTAACTTACTTGCTTCAAAACTGTACTGACTTCCTTATGTGTATTATTTTTGATATTCAGCTGGGTTGTGGATTTCTATGGAA

Reverse complement sequence

TTCCATAGAAATCCACAACCCAGCTGAATATCAAAAATAATACACATAAGGAAGTCAGTACAGTTTTGAAGCAAGTAAGTTACTACAATTTTGCGTAGTT[T/A]
GTACAGTTTGTGTTTGCTGGAAGTAAATCAGTACAATTTTGAACTATAGAACAAACACTAAAAATGTAACTTGTAAACTTAGTTACTTTTTTACCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 5.50% 3.34% 7.96% NA
All Indica  2759 78.30% 9.20% 5.18% 7.36% NA
All Japonica  1512 98.90% 0.10% 0.33% 0.60% NA
Aus  269 41.30% 0.40% 1.86% 56.51% NA
Indica I  595 72.40% 14.80% 3.03% 9.75% NA
Indica II  465 86.00% 4.30% 4.95% 4.73% NA
Indica III  913 78.50% 8.70% 6.57% 6.24% NA
Indica Intermediate  786 77.90% 8.40% 5.34% 8.40% NA
Temperate Japonica  767 99.00% 0.10% 0.00% 0.91% NA
Tropical Japonica  504 98.60% 0.20% 0.79% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 80.00% 4.40% 5.56% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209213128 A -> T LOC_Os02g16200.1 upstream_gene_variant ; 2797.0bp to feature; MODIFIER silent_mutation Average:11.092; most accessible tissue: Minghui63 flower, score: 20.111 N N N N
vg0209213128 A -> T LOC_Os02g16220.1 downstream_gene_variant ; 2139.0bp to feature; MODIFIER silent_mutation Average:11.092; most accessible tissue: Minghui63 flower, score: 20.111 N N N N
vg0209213128 A -> T LOC_Os02g16210.1 intron_variant ; MODIFIER silent_mutation Average:11.092; most accessible tissue: Minghui63 flower, score: 20.111 N N N N
vg0209213128 A -> DEL N N silent_mutation Average:11.092; most accessible tissue: Minghui63 flower, score: 20.111 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209213128 NA 1.65E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 2.22E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 1.43E-07 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 9.05E-08 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 1.97E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 8.15E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 1.66E-07 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 3.66E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 2.08E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 9.52E-06 mr1567_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 6.64E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 2.68E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 4.82E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 4.81E-06 NA mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 5.03E-06 NA mr1846_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 9.15E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 9.30E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 7.33E-06 9.51E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209213128 NA 1.72E-06 mr1930_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251