Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208849037:

Variant ID: vg0208849037 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8849037
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

GCAGGTACAATAGCAGACTGTAAGCCGCTATAAACACATATTGAGTATATAAAAGAGGAGAGAAGAGAAGCGGGCTACAGATTTGTAGCCAGCTATAGCA[C/T]
GGACTAAAACACAATGTTTGTATGACATATGAAACCTTGTATTAATAGTGCAATATAGGTTTATAGGTAACTATTGTATGAATTGGCTATTAAATCAGTT

Reverse complement sequence

AACTGATTTAATAGCCAATTCATACAATAGTTACCTATAAACCTATATTGCACTATTAATACAAGGTTTCATATGTCATACAAACATTGTGTTTTAGTCC[G/A]
TGCTATAGCTGGCTACAAATCTGTAGCCCGCTTCTCTTCTCTCCTCTTTTATATACTCAATATGTGTTTATAGCGGCTTACAGTCTGCTATTGTACCTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	21.80%	0.76%	23.34%	NA
All Indica	2759	34.00%	27.70%	1.20%	37.19%	NA
All Japonica	1512	97.90%	0.90%	0.07%	1.19%	NA
Aus	269	2.60%	81.00%	0.37%	15.99%	NA
Indica I	595	3.20%	50.40%	0.50%	45.88%	NA
Indica II	465	23.90%	37.20%	1.94%	36.99%	NA
Indica III	913	63.60%	7.90%	0.88%	27.60%	NA
Indica Intermediate	786	28.80%	27.70%	1.65%	41.86%	NA
Temperate Japonica	767	98.30%	0.80%	0.00%	0.91%	NA
Tropical Japonica	504	97.80%	0.20%	0.20%	1.79%	NA
Japonica Intermediate	241	96.70%	2.50%	0.00%	0.83%	NA
VI/Aromatic	96	79.20%	19.80%	1.04%	0.00%	NA
Intermediate	90	63.30%	18.90%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208849037	C -> T	LOC_Os02g15700.1	upstream_gene_variant ; 4788.0bp to feature; MODIFIER	silent_mutation	Average:31.872; most accessible tissue: Callus, score: 85.232	N	N	N	N
vg0208849037	C -> T	LOC_Os02g15704.1	upstream_gene_variant ; 1586.0bp to feature; MODIFIER	silent_mutation	Average:31.872; most accessible tissue: Callus, score: 85.232	N	N	N	N
vg0208849037	C -> T	LOC_Os02g15700-LOC_Os02g15704	intergenic_region ; MODIFIER	silent_mutation	Average:31.872; most accessible tissue: Callus, score: 85.232	N	N	N	N
vg0208849037	C -> DEL	N	N	silent_mutation	Average:31.872; most accessible tissue: Callus, score: 85.232	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208849037	NA	4.10E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	1.59E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	6.45E-08	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	3.13E-11	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	9.46E-09	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	2.82E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	1.02E-08	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	2.03E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	1.77E-09	mr1420	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	1.95E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	5.57E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	1.13E-10	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	2.19E-09	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	3.57E-07	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	1.08E-12	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	2.24E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	1.76E-10	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	2.04E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	7.60E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	2.02E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	3.17E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	3.17E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	8.57E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	4.42E-07	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	3.41E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	3.96E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	6.36E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	5.15E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037	NA	6.55E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251