\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208849037:

Variant ID: vg0208849037 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8849037
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGGTACAATAGCAGACTGTAAGCCGCTATAAACACATATTGAGTATATAAAAGAGGAGAGAAGAGAAGCGGGCTACAGATTTGTAGCCAGCTATAGCA[C/T]
GGACTAAAACACAATGTTTGTATGACATATGAAACCTTGTATTAATAGTGCAATATAGGTTTATAGGTAACTATTGTATGAATTGGCTATTAAATCAGTT

Reverse complement sequence

AACTGATTTAATAGCCAATTCATACAATAGTTACCTATAAACCTATATTGCACTATTAATACAAGGTTTCATATGTCATACAAACATTGTGTTTTAGTCC[G/A]
TGCTATAGCTGGCTACAAATCTGTAGCCCGCTTCTCTTCTCTCCTCTTTTATATACTCAATATGTGTTTATAGCGGCTTACAGTCTGCTATTGTACCTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 21.80% 0.76% 23.34% NA
All Indica  2759 34.00% 27.70% 1.20% 37.19% NA
All Japonica  1512 97.90% 0.90% 0.07% 1.19% NA
Aus  269 2.60% 81.00% 0.37% 15.99% NA
Indica I  595 3.20% 50.40% 0.50% 45.88% NA
Indica II  465 23.90% 37.20% 1.94% 36.99% NA
Indica III  913 63.60% 7.90% 0.88% 27.60% NA
Indica Intermediate  786 28.80% 27.70% 1.65% 41.86% NA
Temperate Japonica  767 98.30% 0.80% 0.00% 0.91% NA
Tropical Japonica  504 97.80% 0.20% 0.20% 1.79% NA
Japonica Intermediate  241 96.70% 2.50% 0.00% 0.83% NA
VI/Aromatic  96 79.20% 19.80% 1.04% 0.00% NA
Intermediate  90 63.30% 18.90% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208849037 C -> T LOC_Os02g15700.1 upstream_gene_variant ; 4788.0bp to feature; MODIFIER silent_mutation Average:31.872; most accessible tissue: Callus, score: 85.232 N N N N
vg0208849037 C -> T LOC_Os02g15704.1 upstream_gene_variant ; 1586.0bp to feature; MODIFIER silent_mutation Average:31.872; most accessible tissue: Callus, score: 85.232 N N N N
vg0208849037 C -> T LOC_Os02g15700-LOC_Os02g15704 intergenic_region ; MODIFIER silent_mutation Average:31.872; most accessible tissue: Callus, score: 85.232 N N N N
vg0208849037 C -> DEL N N silent_mutation Average:31.872; most accessible tissue: Callus, score: 85.232 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208849037 NA 4.10E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 1.59E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 6.45E-08 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 3.13E-11 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 9.46E-09 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 2.82E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 1.02E-08 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 2.03E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 1.77E-09 mr1420 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 1.95E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 5.57E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 1.13E-10 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 2.19E-09 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 3.57E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 1.08E-12 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 2.24E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 1.76E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 2.04E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 7.60E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 2.02E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 3.17E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 3.17E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 8.57E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 4.42E-07 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 3.41E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 3.96E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 6.36E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 5.15E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208849037 NA 6.55E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251