Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207174816:

Variant ID: vg0207174816 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7174816
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGCCGGAGAAGCTATTGTTGAACACCACAAGGTCGTAGAGCTTTTTGTTGAAGCAGAGCGTATCAGGCAACTCACCAGACAGGTTGTTGTTGGACACCT[C/G]
AAAATTTCCCAATTCTGAATATTTCCCAAGCTCAGGGGGTAAGGGCCCGGAGAGCTTATTATTGAAGAGCCGAATGTCGGTAAGGTTTGGAAGCATACTG

Reverse complement sequence

CAGTATGCTTCCAAACCTTACCGACATTCGGCTCTTCAATAATAAGCTCTCCGGGCCCTTACCCCCTGAGCTTGGGAAATATTCAGAATTGGGAAATTTT[G/C]
AGGTGTCCAACAACAACCTGTCTGGTGAGTTGCCTGATACGCTCTGCTTCAACAAAAAGCTCTACGACCTTGTGGTGTTCAACAATAGCTTCTCCGGCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	1.10%	6.39%	26.83%	NA
All Indica	2759	65.60%	0.20%	9.82%	24.36%	NA
All Japonica	1512	59.50%	3.00%	1.65%	35.91%	NA
Aus	269	87.70%	0.00%	0.37%	11.90%	NA
Indica I	595	75.30%	0.00%	9.75%	14.96%	NA
Indica II	465	64.10%	0.00%	7.53%	28.39%	NA
Indica III	913	61.40%	0.40%	8.76%	29.35%	NA
Indica Intermediate	786	64.10%	0.10%	12.47%	23.28%	NA
Temperate Japonica	767	83.60%	2.20%	0.91%	13.30%	NA
Tropical Japonica	504	23.60%	4.00%	2.38%	70.04%	NA
Japonica Intermediate	241	57.70%	3.30%	2.49%	36.51%	NA
VI/Aromatic	96	91.70%	1.00%	0.00%	7.29%	NA
Intermediate	90	77.80%	1.10%	5.56%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207174816	C -> G	LOC_Os02g13430.1	missense_variant ; p.Glu365Gln; MODERATE	nonsynonymous_codon ; E365Q	Average:71.656; most accessible tissue: Zhenshan97 young leaf, score: 85.364	possibly damaging	1.987	TOLERATED	0.05
vg0207174816	C -> DEL	LOC_Os02g13430.1	N	frameshift_variant	Average:71.656; most accessible tissue: Zhenshan97 young leaf, score: 85.364	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207174816	NA	1.36E-07	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.38E-07	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	2.54E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.16E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.12E-06	mr1161	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.82E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.75E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.45E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	2.55E-07	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	4.71E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	3.44E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	9.73E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.81E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.82E-12	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	5.42E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.31E-08	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	7.93E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	9.62E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	4.47E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	3.17E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	9.90E-06	NA	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	3.95E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.51E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.62E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	7.43E-11	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	6.78E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.41E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.14E-21	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	5.53E-08	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	2.67E-10	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	6.86E-08	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	8.74E-12	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.68E-20	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	2.63E-09	mr1715	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	3.32E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	3.84E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.05E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	8.14E-06	1.02E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	4.51E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	1.59E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	3.02E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	5.32E-06	mr1968	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	3.45E-06	1.26E-07	mr1991	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	6.33E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207174816	NA	7.48E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251