\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206250874:

Variant ID: vg0206250874 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6250874
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, G: 0.19, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTGAGTTGACTTCATTTCTCAGGTCGATCACATATTATGTGCTTGGTTACTTTATACTGTCGAATATTGGTGGAGATGCCTAATGTGATGTCCTCCAT[C/G]
CGTTGTTGACTGAAGGATTACATTATATATAGTTATATATGATTTTAGATGGGAGAGTGGTGCCTAAGTTGGATTTCAAAGATGGCCAACAGTGAATATC

Reverse complement sequence

GATATTCACTGTTGGCCATCTTTGAAATCCAACTTAGGCACCACTCTCCCATCTAAAATCATATATAACTATATATAATGTAATCCTTCAGTCAACAACG[G/C]
ATGGAGGACATCACATTAGGCATCTCCACCAATATTCGACAGTATAAAGTAACCAAGCACATAATATGTGATCGACCTGAGAAATGAAGTCAACTCAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 38.80% 0.00% 0.34% NA
All Indica  2759 88.40% 11.10% 0.00% 0.58% NA
All Japonica  1512 3.50% 96.50% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.00% 0.17% NA
Indica II  465 74.40% 24.10% 0.00% 1.51% NA
Indica III  913 86.20% 13.30% 0.00% 0.55% NA
Indica Intermediate  786 90.70% 8.90% 0.00% 0.38% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 4.20% 95.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206250874 C -> G LOC_Os02g12030.1 upstream_gene_variant ; 275.0bp to feature; MODIFIER silent_mutation Average:53.592; most accessible tissue: Zhenshan97 root, score: 97.275 N N N N
vg0206250874 C -> G LOC_Os02g12040.1 downstream_gene_variant ; 3472.0bp to feature; MODIFIER silent_mutation Average:53.592; most accessible tissue: Zhenshan97 root, score: 97.275 N N N N
vg0206250874 C -> G LOC_Os02g12030-LOC_Os02g12040 intergenic_region ; MODIFIER silent_mutation Average:53.592; most accessible tissue: Zhenshan97 root, score: 97.275 N N N N
vg0206250874 C -> DEL N N silent_mutation Average:53.592; most accessible tissue: Zhenshan97 root, score: 97.275 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0206250874 C G -0.08 -0.06 -0.06 -0.01 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206250874 NA 1.12E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0206250874 NA 5.74E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 8.53E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 8.01E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 1.85E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 5.53E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 4.72E-41 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 1.89E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 1.71E-64 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 2.04E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 2.75E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 1.63E-28 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 5.66E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 5.38E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 2.39E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 1.24E-36 mr1780_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 1.30E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206250874 NA 2.37E-24 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251