Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205347458:

Variant ID: vg0205347458 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 5347458
Reference Allele: TCTCTCAAlternative Allele: T
Primary Allele: TCTCTCASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGGCGGAGGCCGAGGCGGCGGTGGCGGAGGAGGCGTGCGGGGATTGGAATCGCGAGCTCGGTGCGCGTGGTGGCGTCTCCTCTCTCTCTCTCTCTCTC[TCTCTCA/T]
CTCTCTCTCTTCAGGGGAAGGTGGGGGTGGGGGGAGAGAGAGACACTGATAAAAAAGAAAGCCCCCGATGGCGACGGGGAAATTACCGGTTTGCCCCTCG

Reverse complement sequence

CGAGGGGCAAACCGGTAATTTCCCCGTCGCCATCGGGGGCTTTCTTTTTTATCAGTGTCTCTCTCTCCCCCCACCCCCACCTTCCCCTGAAGAGAGAGAG[TGAGAGA/A]
GAGAGAGAGAGAGAGAGAGGAGACGCCACCACGCGCACCGAGCTCGCGATTCCAATCCCCGCACGCCTCCTCCGCCACCGCCGCCTCGGCCTCCGCCGCC

Allele Frequencies:

Populations Population SizeFrequency of TCTCTCA(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 20.40% 2.48% 0.25% NA
All Indica  2759 71.90% 24.50% 3.15% 0.43% NA
All Japonica  1512 99.30% 0.60% 0.07% 0.00% NA
Aus  269 20.10% 74.00% 5.95% 0.00% NA
Indica I  595 97.80% 0.80% 1.18% 0.17% NA
Indica II  465 55.50% 42.40% 1.94% 0.22% NA
Indica III  913 66.00% 29.70% 3.72% 0.55% NA
Indica Intermediate  786 69.00% 25.70% 4.71% 0.64% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 65.60% 10.42% 0.00% NA
Intermediate  90 76.70% 20.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205347458 TCTCTCA -> T LOC_Os02g10200.1 5_prime_UTR_variant ; 901.0bp to feature; MODIFIER silent_mutation Average:99.53; most accessible tissue: Minghui63 root, score: 99.783 N N N N
vg0205347458 TCTCTCA -> T LOC_Os02g10200.2 5_prime_UTR_variant ; 901.0bp to feature; MODIFIER silent_mutation Average:99.53; most accessible tissue: Minghui63 root, score: 99.783 N N N N
vg0205347458 TCTCTCA -> T LOC_Os02g10210.1 upstream_gene_variant ; 1261.0bp to feature; MODIFIER silent_mutation Average:99.53; most accessible tissue: Minghui63 root, score: 99.783 N N N N
vg0205347458 TCTCTCA -> T LOC_Os02g10220.1 upstream_gene_variant ; 4008.0bp to feature; MODIFIER silent_mutation Average:99.53; most accessible tissue: Minghui63 root, score: 99.783 N N N N
vg0205347458 TCTCTCA -> T LOC_Os02g10190.1 downstream_gene_variant ; 2941.0bp to feature; MODIFIER silent_mutation Average:99.53; most accessible tissue: Minghui63 root, score: 99.783 N N N N
vg0205347458 TCTCTCA -> DEL N N silent_mutation Average:99.53; most accessible tissue: Minghui63 root, score: 99.783 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205347458 TCTCT* T 0.18 0.24 0.22 0.16 0.19 0.22