Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205347448:

Variant ID: vg0205347448 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 5347448
Reference Allele: TCTCTCTCTCTCTCTCA	Alternative Allele: ACTCTCTCTCTCTCTCA,T
Primary Allele: TCTCTCTCTCTCTCTCA	Secondary Allele: ACTCTCTCTCTCTCTCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGTCGCGGCGGCGGCGGAGGCCGAGGCGGCGGTGGCGGAGGAGGCGTGCGGGGATTGGAATCGCGAGCTCGGTGCGCGTGGTGGCGTCTCCTCTCTCTC[TCTCTCTCTCTCTCTCA/ACTCTCTCTCTCTCTCA,T]
CTCTCTCTCTTCAGGGGAAGGTGGGGGTGGGGGGAGAGAGAGACACTGATAAAAAAGAAAGCCCCCGATGGCGACGGGGAAATTACCGGTTTGCCCCTCG

Reverse complement sequence

CGAGGGGCAAACCGGTAATTTCCCCGTCGCCATCGGGGGCTTTCTTTTTTATCAGTGTCTCTCTCTCCCCCCACCCCCACCTTCCCCTGAAGAGAGAGAG[TGAGAGAGAGAGAGAGA/TGAGAGAGAGAGAGAGT,A]
GAGAGAGAGGAGACGCCACCACGCGCACCGAGCTCGCGATTCCAATCCCCGCACGCCTCCTCCGCCACCGCCGCCTCGGCCTCCGCCGCCGCCGCGACCA

Allele Frequencies:

Populations	Population Size	Frequency of TCTCTCTCTCTCTCTCA(primary allele)	Frequency of ACTCTCTCTCTCTCTCA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	0.10%	11.66%	21.63%	T: 0.02%
All Indica	2759	47.20%	0.20%	19.25%	33.38%	T: 0.04%
All Japonica	1512	99.10%	0.10%	0.26%	0.60%	NA
Aus	269	71.00%	0.40%	2.23%	26.39%	NA
Indica I	595	31.90%	0.00%	20.34%	47.73%	NA
Indica II	465	42.80%	0.00%	17.63%	39.57%	NA
Indica III	913	57.70%	0.50%	19.50%	22.12%	T: 0.11%
Indica Intermediate	786	49.00%	0.00%	19.08%	31.93%	NA
Temperate Japonica	767	99.10%	0.00%	0.13%	0.78%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	98.30%	0.40%	0.41%	0.83%	NA
VI/Aromatic	96	88.50%	0.00%	4.17%	7.29%	NA
Intermediate	90	77.80%	0.00%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205347448	TCTCTCTCTCTCTCTCA -> T	LOC_Os02g10200.1	5_prime_UTR_variant ; 891.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> T	LOC_Os02g10200.2	5_prime_UTR_variant ; 891.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> T	LOC_Os02g10210.1	upstream_gene_variant ; 1271.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> T	LOC_Os02g10220.1	upstream_gene_variant ; 4018.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> T	LOC_Os02g10190.1	downstream_gene_variant ; 2931.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> ACTCTCTCTCTCTCTCA	LOC_Os02g10200.1	5_prime_UTR_variant ; 890.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> ACTCTCTCTCTCTCTCA	LOC_Os02g10200.2	5_prime_UTR_variant ; 890.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> ACTCTCTCTCTCTCTCA	LOC_Os02g10210.1	upstream_gene_variant ; 1272.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> ACTCTCTCTCTCTCTCA	LOC_Os02g10220.1	upstream_gene_variant ; 4019.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> ACTCTCTCTCTCTCTCA	LOC_Os02g10190.1	downstream_gene_variant ; 2930.0bp to feature; MODIFIER	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N
vg0205347448	TCTCTCTCTCTCTCTCA -> DEL	N	N	silent_mutation	Average:99.516; most accessible tissue: Minghui63 root, score: 99.774	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0205347448	TCTCT*	ACTCT*	-0.01	-0.01	-0.03	0.02	-0.01	-0.01
vg0205347448	TCTCT*	T	-0.16	-0.17	-0.12	-0.17	-0.11	-0.1