Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205347344:

Variant ID: vg0205347344 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 5347344
Reference Allele: ACAlternative Allele: A
Primary Allele: ACSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACAAAAAAAAGAAAAAGAAGCCCACAGATCAAACGGGTCACCCACAAACTCAAGGGGGGGGGTGGAATCAGGCAGGGGGAGCAAGAGGGCAAACCCTA[AC/A]
CCTGGTCGCGGCGGCGGCGGAGGCCGAGGCGGCGGTGGCGGAGGAGGCGTGCGGGGATTGGAATCGCGAGCTCGGTGCGCGTGGTGGCGTCTCCTCTCTC

Reverse complement sequence

GAGAGAGGAGACGCCACCACGCGCACCGAGCTCGCGATTCCAATCCCCGCACGCCTCCTCCGCCACCGCCGCCTCGGCCTCCGCCGCCGCCGCGACCAGG[GT/T]
TAGGGTTTGCCCTCTTGCTCCCCCTGCCTGATTCCACCCCCCCCCTTGAGTTTGTGGGTGACCCGTTTGATCTGTGGGCTTCTTTTTCTTTTTTTTGTTT

Allele Frequencies:

Populations Population SizeFrequency of AC(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 39.40% 0.04% 0.00% NA
All Indica  2759 34.10% 65.80% 0.07% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 9.60% 90.30% 0.17% 0.00% NA
Indica II  465 48.20% 51.60% 0.22% 0.00% NA
Indica III  913 41.30% 58.70% 0.00% 0.00% NA
Indica Intermediate  786 36.00% 64.00% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205347344 AC -> A LOC_Os02g10200.1 splice_donor_variant&intron_variant ; HIGH silent_mutation Average:98.115; most accessible tissue: Zhenshan97 flower, score: 99.257 N N N N
vg0205347344 AC -> A LOC_Os02g10200.2 5_prime_UTR_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:98.115; most accessible tissue: Zhenshan97 flower, score: 99.257 N N N N
vg0205347344 AC -> A LOC_Os02g10210.1 upstream_gene_variant ; 1375.0bp to feature; MODIFIER silent_mutation Average:98.115; most accessible tissue: Zhenshan97 flower, score: 99.257 N N N N
vg0205347344 AC -> A LOC_Os02g10220.1 upstream_gene_variant ; 4122.0bp to feature; MODIFIER silent_mutation Average:98.115; most accessible tissue: Zhenshan97 flower, score: 99.257 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205347344 AC A -0.01 -0.04 -0.05 -0.04 -0.03 -0.02