Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205346277:

Variant ID: vg0205346277 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5346277
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTGAATCCCGTCAGCCCAACCCTCTTCCTACAGGTAGCGCACCGGTTCGGCCCTTCCTTGACCTTGGGGACTACAGCAACCTCCTCGCTGGTGCCCGC[G/A]
ACATCGGTAGGCTGCACAACGAGCGTCTTCGCCTCGACCTGAGCCACCGCCACCGCCGTGCTACCACTGGCAGCAACAATATGCTCCTTCCCACCGTCAC

Reverse complement sequence

GTGACGGTGGGAAGGAGCATATTGTTGCTGCCAGTGGTAGCACGGCGGTGGCGGTGGCTCAGGTCGAGGCGAAGACGCTCGTTGTGCAGCCTACCGATGT[C/T]
GCGGGCACCAGCGAGGAGGTTGCTGTAGTCCCCAAGGTCAAGGAAGGGCCGAACCGGTGCGCTACCTGTAGGAAGAGGGTTGGGCTGACGGGATTCAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.20% 23.50% 0.23% 0.11% NA
All Indica  2759 72.00% 27.50% 0.40% 0.14% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 14.10% 85.50% 0.00% 0.37% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 53.10% 45.60% 1.08% 0.22% NA
Indica III  913 64.70% 34.90% 0.22% 0.11% NA
Indica Intermediate  786 71.40% 27.90% 0.51% 0.25% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205346277 G -> A LOC_Os02g10200.1 synonymous_variant ; p.Val94Val; LOW synonymous_codon Average:83.961; most accessible tissue: Zhenshan97 young leaf, score: 93.722 N N N N
vg0205346277 G -> A LOC_Os02g10200.2 synonymous_variant ; p.Val94Val; LOW synonymous_codon Average:83.961; most accessible tissue: Zhenshan97 young leaf, score: 93.722 N N N N
vg0205346277 G -> DEL LOC_Os02g10200.1 N frameshift_variant Average:83.961; most accessible tissue: Zhenshan97 young leaf, score: 93.722 N N N N
vg0205346277 G -> DEL LOC_Os02g10200.2 N frameshift_variant Average:83.961; most accessible tissue: Zhenshan97 young leaf, score: 93.722 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205346277 G A -0.03 -0.02 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205346277 NA 7.70E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 1.07E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 6.11E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 2.62E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 2.90E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 5.52E-06 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 7.89E-08 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 5.15E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 2.43E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 1.84E-10 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 3.75E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 1.74E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 3.42E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 5.18E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 5.31E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 3.76E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 3.28E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 3.93E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 1.41E-10 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 2.07E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 4.11E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 3.38E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 1.29E-13 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 1.45E-09 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 1.39E-11 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 1.25E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 6.99E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205346277 NA 2.21E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251