Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204869246:

Variant ID: vg0204869246 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 4869246
Reference Allele: GA	Alternative Allele: G,GAA,GAAA,GAAAA
Primary Allele: GA	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGTAATCTTTAATTGCCACTTTAAATAGTTAAATATTTTTATTTTGGAGCTATATGGCCGTACTCGAGCTGTAAATAACCGATGATCTTTTCTTTTTG[GA/G,GAA,GAAA,GAAAA]
AAAAAAAAAGCCTTTGTTTCGAATGTATAGGAATTTTCTGAGAATCTGAAAGTACTTATATTCCTCAGAACCGTAAGAACTTGTTTCTTATTGGCCGCTT

Reverse complement sequence

AAGCGGCCAATAAGAAACAAGTTCTTACGGTTCTGAGGAATATAAGTACTTTCAGATTCTCAGAAAATTCCTATACATTCGAAACAAAGGCTTTTTTTTT[TC/C,TTC,TTTC,TTTTC]
CAAAAAGAAAAGATCATCGGTTATTTACAGCTCGAGTACGGCCATATAGCTCCAAAATAAAAATATTTAACTATTTAAAGTGGCAATTAAAGATTACCCA

Allele Frequencies:

Populations	Population Size	Frequency of GA(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.50%	33.00%	2.52%	0.00%	GAA: 23.57%; GAAA: 0.44%; GAAAA: 0.04%
All Indica	2759	27.80%	46.70%	3.62%	0.00%	GAA: 21.28%; GAAA: 0.62%; GAAAA: 0.04%
All Japonica	1512	66.20%	1.20%	1.06%	0.00%	GAA: 31.35%; GAAA: 0.20%
Aus	269	21.90%	69.10%	0.00%	0.00%	GAA: 8.55%; GAAAA: 0.37%
Indica I	595	26.60%	32.60%	10.25%	0.00%	GAA: 28.57%; GAAA: 1.85%; GAAAA: 0.17%
Indica II	465	28.20%	49.70%	1.08%	0.00%	GAA: 21.08%
Indica III	913	26.30%	60.80%	0.55%	0.00%	GAA: 11.83%; GAAA: 0.55%
Indica Intermediate	786	30.20%	39.20%	3.69%	0.00%	GAA: 26.84%; GAAA: 0.13%
Temperate Japonica	767	92.70%	0.70%	0.91%	0.00%	GAA: 5.74%
Tropical Japonica	504	36.30%	1.00%	0.79%	0.00%	GAA: 61.71%; GAAA: 0.20%
Japonica Intermediate	241	44.40%	3.30%	2.07%	0.00%	GAA: 49.38%; GAAA: 0.83%
VI/Aromatic	96	49.00%	44.80%	0.00%	0.00%	GAA: 6.25%
Intermediate	90	43.30%	25.60%	3.33%	0.00%	GAA: 26.67%; GAAA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204869246	GA -> G	LOC_Os02g09480.1	3_prime_UTR_variant ; 611.0bp to feature; MODIFIER	silent_mutation	Average:95.622; most accessible tissue: Minghui63 young leaf, score: 98.324	N	N	N	N
vg0204869246	GA -> G	LOC_Os02g09490.1	downstream_gene_variant ; 895.0bp to feature; MODIFIER	silent_mutation	Average:95.622; most accessible tissue: Minghui63 young leaf, score: 98.324	N	N	N	N
vg0204869246	GA -> GAA	LOC_Os02g09480.1	3_prime_UTR_variant ; 612.0bp to feature; MODIFIER	silent_mutation	Average:95.622; most accessible tissue: Minghui63 young leaf, score: 98.324	N	N	N	N
vg0204869246	GA -> GAA	LOC_Os02g09490.1	downstream_gene_variant ; 894.0bp to feature; MODIFIER	silent_mutation	Average:95.622; most accessible tissue: Minghui63 young leaf, score: 98.324	N	N	N	N
vg0204869246	GA -> GAAAA	LOC_Os02g09480.1	3_prime_UTR_variant ; 612.0bp to feature; MODIFIER	silent_mutation	Average:95.622; most accessible tissue: Minghui63 young leaf, score: 98.324	N	N	N	N
vg0204869246	GA -> GAAAA	LOC_Os02g09490.1	downstream_gene_variant ; 894.0bp to feature; MODIFIER	silent_mutation	Average:95.622; most accessible tissue: Minghui63 young leaf, score: 98.324	N	N	N	N
vg0204869246	GA -> GAAA	LOC_Os02g09480.1	3_prime_UTR_variant ; 612.0bp to feature; MODIFIER	silent_mutation	Average:95.622; most accessible tissue: Minghui63 young leaf, score: 98.324	N	N	N	N
vg0204869246	GA -> GAAA	LOC_Os02g09490.1	downstream_gene_variant ; 894.0bp to feature; MODIFIER	silent_mutation	Average:95.622; most accessible tissue: Minghui63 young leaf, score: 98.324	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0204869246	GA	G	0.07	-0.08	-0.05	0.08	-0.06	-0.11
vg0204869246	GA	GAA	0.06	-0.01	-0.1	0.05	0.02	-0.02
vg0204869246	GA	GAAA	0.16	0.07	-0.06	0.17	0.09	0.1
vg0204869246	GA	GAAAA	0.14	0.19	0.1	0.11	0.11	0.14