Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204869035:

Variant ID: vg0204869035 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4869035
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, A: 0.29, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TGATGGTGAGATGTAGCGACAGGTTTCTCCTTCCCTTTGAACCGTCCGTGCAACGAAGAGTCGAAGACTACTTGGGCATCGATCAGATGTGCGAGTTGAA[A/T]
GTGATAGTAGTAGCAGCATGCTGTACTAGCAGTACGCATATTGGACATTTCAGAGCATCTAACTTTTAAATGTGGCAATTAAGGATTTACCAACCACAAT

Reverse complement sequence

ATTGTGGTTGGTAAATCCTTAATTGCCACATTTAAAAGTTAGATGCTCTGAAATGTCCAATATGCGTACTGCTAGTACAGCATGCTGCTACTACTATCAC[T/A]
TTCAACTCGCACATCTGATCGATGCCCAAGTAGTCTTCGACTCTTCGTTGCACGGACGGTTCAAAGGGAAGGAGAAACCTGTCGCTACATCTCACCATCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	26.50%	0.08%	0.00%	NA
All Indica	2759	91.80%	8.20%	0.04%	0.00%	NA
All Japonica	1512	34.00%	65.90%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	87.10%	12.70%	0.22%	0.00%	NA
Indica III	913	89.00%	11.00%	0.00%	0.00%	NA
Indica Intermediate	786	92.40%	7.60%	0.00%	0.00%	NA
Temperate Japonica	767	6.30%	93.70%	0.00%	0.00%	NA
Tropical Japonica	504	65.90%	33.90%	0.20%	0.00%	NA
Japonica Intermediate	241	55.60%	44.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204869035	A -> T	LOC_Os02g09480.1	3_prime_UTR_variant ; 390.0bp to feature; MODIFIER	silent_mutation	Average:96.956; most accessible tissue: Minghui63 young leaf, score: 98.721	N	N	N	N
vg0204869035	A -> T	LOC_Os02g09490.1	downstream_gene_variant ; 1107.0bp to feature; MODIFIER	silent_mutation	Average:96.956; most accessible tissue: Minghui63 young leaf, score: 98.721	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0204869035	A	T	-0.11	-0.15	-0.14	-0.06	-0.12	-0.15

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204869035	NA	3.53E-12	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	4.45E-14	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	3.60E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	1.96E-09	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	9.87E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	5.89E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	9.38E-06	mr1388_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	5.28E-07	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	1.17E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	2.92E-06	mr1620_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	1.30E-06	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	2.68E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	3.15E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204869035	NA	2.90E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251