Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204868659:

Variant ID: vg0204868659 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 4868659
Reference Allele: TAAlternative Allele: TAA,T,TAAA
Primary Allele: TASecondary Allele: TAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGTGGCCGAGTCCTTCATGCCGCAGCTCGTCGACGGCGTCATGCGCGCCGCCGCCGAGAGGGTCGGCGTCGTGACCCGCCAATAAAACCCCCCAAAAA[TA/TAA,T,TAAA]
AAAAAAAAATCAACCATCCCGGTTCAAATTCACCACAAATGCACGGTGAAAAACCACCTGTTAATTATGAGATCTGTGTAGTATTATTAGCACTAGAATT

Reverse complement sequence

AATTCTAGTGCTAATAATACTACACAGATCTCATAATTAACAGGTGGTTTTTCACCGTGCATTTGTGGTGAATTTGAACCGGGATGGTTGATTTTTTTTT[TA/TTA,A,TTTA]
TTTTTGGGGGGTTTTATTGGCGGGTCACGACGCCGACCCTCTCGGCGGCGGCGCGCATGACGCCGTCGACGAGCTGCGGCATGAAGGACTCGGCCACGGC

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of TAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 15.40% 0.57% 0.00% TAAA: 0.23%; T: 0.13%
All Indica  2759 85.00% 14.50% 0.47% 0.00% T: 0.07%
All Japonica  1512 99.20% 0.60% 0.20% 0.00% NA
Aus  269 11.90% 82.50% 2.97% 0.00% TAAA: 1.49%; T: 1.12%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 75.50% 23.00% 1.51% 0.00% NA
Indica III  913 79.10% 20.70% 0.11% 0.00% T: 0.11%
Indica Intermediate  786 86.10% 13.10% 0.64% 0.00% T: 0.13%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.83% 0.00% NA
VI/Aromatic  96 12.50% 80.20% 2.08% 0.00% TAAA: 5.21%
Intermediate  90 72.20% 23.30% 1.11% 0.00% TAAA: 2.22%; T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204868659 TA -> TAA LOC_Os02g09480.1 3_prime_UTR_variant ; 25.0bp to feature; MODIFIER silent_mutation Average:92.96; most accessible tissue: Minghui63 panicle, score: 98.021 N N N N
vg0204868659 TA -> TAA LOC_Os02g09490.1 downstream_gene_variant ; 1481.0bp to feature; MODIFIER silent_mutation Average:92.96; most accessible tissue: Minghui63 panicle, score: 98.021 N N N N
vg0204868659 TA -> TAAA LOC_Os02g09480.1 3_prime_UTR_variant ; 25.0bp to feature; MODIFIER silent_mutation Average:92.96; most accessible tissue: Minghui63 panicle, score: 98.021 N N N N
vg0204868659 TA -> TAAA LOC_Os02g09490.1 downstream_gene_variant ; 1481.0bp to feature; MODIFIER silent_mutation Average:92.96; most accessible tissue: Minghui63 panicle, score: 98.021 N N N N
vg0204868659 TA -> T LOC_Os02g09480.1 3_prime_UTR_variant ; 24.0bp to feature; MODIFIER silent_mutation Average:92.96; most accessible tissue: Minghui63 panicle, score: 98.021 N N N N
vg0204868659 TA -> T LOC_Os02g09490.1 downstream_gene_variant ; 1482.0bp to feature; MODIFIER silent_mutation Average:92.96; most accessible tissue: Minghui63 panicle, score: 98.021 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0204868659 TA T -0.14 -0.03 -0.02 -0.16 -0.08 -0.05
vg0204868659 TA TAA -0.04 0.04 0.04 -0.05 -0.01 -0.02
vg0204868659 TA TAAA 0.04 0.12 0.11 -0.01 0.04 0.04