Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204868658:

Variant ID: vg0204868658 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 4868658
Reference Allele: AAlternative Allele: AT
Primary Allele: ASecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCGTGGCCGAGTCCTTCATGCCGCAGCTCGTCGACGGCGTCATGCGCGCCGCCGCCGAGAGGGTCGGCGTCGTGACCCGCCAATAAAACCCCCCAAAA[A/AT]
TAAAAAAAAAATCAACCATCCCGGTTCAAATTCACCACAAATGCACGGTGAAAAACCACCTGTTAATTATGAGATCTGTGTAGTATTATTAGCACTAGAA

Reverse complement sequence

TTCTAGTGCTAATAATACTACACAGATCTCATAATTAACAGGTGGTTTTTCACCGTGCATTTGTGGTGAATTTGAACCGGGATGGTTGATTTTTTTTTTA[T/AT]
TTTTGGGGGGTTTTATTGGCGGGTCACGACGCCGACCCTCTCGGCGGCGGCGCGCATGACGCCGTCGACGAGCTGCGGCATGAAGGACTCGGCCACGGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 0.10% 3.32% 0.51% NA
All Indica  2759 95.40% 0.00% 4.06% 0.58% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 89.20% 0.00% 9.29% 1.49% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.50% 0.00% 9.25% 0.22% NA
Indica III  913 94.90% 0.00% 4.05% 1.10% NA
Indica Intermediate  786 95.30% 0.00% 4.07% 0.64% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 82.30% 2.10% 12.50% 3.12% NA
Intermediate  90 91.10% 2.20% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204868658 A -> AT LOC_Os02g09480.1 3_prime_UTR_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:92.953; most accessible tissue: Minghui63 panicle, score: 98.038 N N N N
vg0204868658 A -> AT LOC_Os02g09490.1 downstream_gene_variant ; 1483.0bp to feature; MODIFIER silent_mutation Average:92.953; most accessible tissue: Minghui63 panicle, score: 98.038 N N N N
vg0204868658 A -> DEL N N silent_mutation Average:92.953; most accessible tissue: Minghui63 panicle, score: 98.038 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0204868658 A AT 0.1 -0.15 -0.08 0.0 0.01 0.09