\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203536993:

Variant ID: vg0203536993 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3536993
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAATTAATCTATTCGTTTTTCAAATAGCTAATACTTAATTAATCACGCACTAATGGACCGCTCCGTTTTTCGTGTGGAGGGAATAAGTTCCCATTCACC[A/G]
TATGCGAACACAGTGTAATGGGACATCATCAATGTTACTATACCATCATATTGAACCATGGCTTCAATGATATTGGTGTCGTGAAAAGATCTATTTTTGA

Reverse complement sequence

TCAAAAATAGATCTTTTCACGACACCAATATCATTGAAGCCATGGTTCAATATGATGGTATAGTAACATTGATGATGTCCCATTACACTGTGTTCGCATA[T/C]
GGTGAATGGGAACTTATTCCCTCCACACGAAAAACGGAGCGGTCCATTAGTGCGTGATTAATTAAGTATTAGCTATTTGAAAAACGAATAGATTAATTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 10.60% 1.52% 0.00% NA
All Indica  2759 97.00% 2.20% 0.76% 0.00% NA
All Japonica  1512 74.60% 22.40% 2.98% 0.00% NA
Aus  269 79.20% 20.40% 0.37% 0.00% NA
Indica I  595 98.70% 0.50% 0.84% 0.00% NA
Indica II  465 98.90% 0.20% 0.86% 0.00% NA
Indica III  913 96.30% 3.60% 0.11% 0.00% NA
Indica Intermediate  786 95.40% 3.20% 1.40% 0.00% NA
Temperate Japonica  767 96.00% 0.90% 3.13% 0.00% NA
Tropical Japonica  504 35.30% 61.50% 3.17% 0.00% NA
Japonica Intermediate  241 88.80% 9.10% 2.07% 0.00% NA
VI/Aromatic  96 72.90% 25.00% 2.08% 0.00% NA
Intermediate  90 75.60% 21.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203536993 A -> G LOC_Os02g06960.1 upstream_gene_variant ; 3940.0bp to feature; MODIFIER silent_mutation Average:89.8; most accessible tissue: Zhenshan97 panicle, score: 97.067 N N N N
vg0203536993 A -> G LOC_Os02g06950-LOC_Os02g06960 intergenic_region ; MODIFIER silent_mutation Average:89.8; most accessible tissue: Zhenshan97 panicle, score: 97.067 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0203536993 A G 0.0 0.01 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203536993 NA 8.74E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203536993 NA 8.88E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203536993 NA 1.52E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203536993 NA 3.26E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203536993 NA 2.92E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203536993 NA 3.63E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203536993 NA 9.58E-09 mr1606_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203536993 NA 1.33E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251