Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203416075:

Variant ID: vg0203416075 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3416075
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, G: 0.33, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAAAATATGCCTGCCTGCACAATTCAGATACCAAAGTTAAAATAACCAGTCGAGTTGGAGAAACTATTTGCCGGACTCAACTCAAATTGATTATTATG[G/T]
TGCGCATGTAATGAGGGCAGTACTTGTCAGCAGGCATGCAGCAGCATTACTGATAGTCAAACAATGAGAAGTTAGATGCAAGAAGTTTCTGATAACAAAA

Reverse complement sequence

TTTTGTTATCAGAAACTTCTTGCATCTAACTTCTCATTGTTTGACTATCAGTAATGCTGCTGCATGCCTGCTGACAAGTACTGCCCTCATTACATGCGCA[C/A]
CATAATAATCAATTTGAGTTGAGTCCGGCAAATAGTTTCTCCAACTCGACTGGTTATTTTAACTTTGGTATCTGAATTGTGCAGGCAGGCATATTTTCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.10%	13.30%	0.59%	69.04%	NA
All Indica	2759	4.90%	3.50%	0.72%	90.90%	NA
All Japonica	1512	40.50%	20.90%	0.26%	38.36%	NA
Aus	269	11.90%	73.60%	0.00%	14.50%	NA
Indica I	595	9.20%	0.30%	1.18%	89.24%	NA
Indica II	465	1.90%	0.90%	0.22%	96.99%	NA
Indica III	913	3.00%	5.70%	0.33%	91.02%	NA
Indica Intermediate	786	5.50%	5.00%	1.15%	88.42%	NA
Temperate Japonica	767	37.90%	33.10%	0.39%	28.55%	NA
Tropical Japonica	504	52.80%	1.40%	0.20%	45.63%	NA
Japonica Intermediate	241	22.80%	22.80%	0.00%	54.36%	NA
VI/Aromatic	96	5.20%	2.10%	2.08%	90.62%	NA
Intermediate	90	25.60%	17.80%	2.22%	54.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203416075	G -> T	LOC_Os02g06760.1	downstream_gene_variant ; 770.0bp to feature; MODIFIER	silent_mutation	Average:12.529; most accessible tissue: Callus, score: 77.9	N	N	N	N
vg0203416075	G -> T	LOC_Os02g06779.1	downstream_gene_variant ; 4097.0bp to feature; MODIFIER	silent_mutation	Average:12.529; most accessible tissue: Callus, score: 77.9	N	N	N	N
vg0203416075	G -> T	LOC_Os02g06760.2	downstream_gene_variant ; 771.0bp to feature; MODIFIER	silent_mutation	Average:12.529; most accessible tissue: Callus, score: 77.9	N	N	N	N
vg0203416075	G -> T	LOC_Os02g06760.3	downstream_gene_variant ; 770.0bp to feature; MODIFIER	silent_mutation	Average:12.529; most accessible tissue: Callus, score: 77.9	N	N	N	N
vg0203416075	G -> T	LOC_Os02g06770.1	intron_variant ; MODIFIER	silent_mutation	Average:12.529; most accessible tissue: Callus, score: 77.9	N	N	N	N
vg0203416075	G -> T	LOC_Os02g06770.2	intron_variant ; MODIFIER	silent_mutation	Average:12.529; most accessible tissue: Callus, score: 77.9	N	N	N	N
vg0203416075	G -> T	LOC_Os02g06770.3	intron_variant ; MODIFIER	silent_mutation	Average:12.529; most accessible tissue: Callus, score: 77.9	N	N	N	N
vg0203416075	G -> DEL	N	N	silent_mutation	Average:12.529; most accessible tissue: Callus, score: 77.9	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203416075	NA	8.87E-06	mr1897	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075	NA	6.49E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075	NA	3.52E-07	mr1446_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075	NA	6.59E-06	mr1446_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075	NA	4.21E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075	NA	1.00E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251