Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202764681:

Variant ID: vg0202764681 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2764681
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.17, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTTTTTTGTAAAAATTTTCTATAGGAAATTTGCTTTAAAAAAATCATATTAATCCATTTTTTAAATTTAAAATAGTTAATACTCAATTAATCATGAGC[A/T]
AATAGCTCACCTCGTTTTGCGTATCCTCCTAATCTCCTCAATCCCCTTCTCCTCAAATACACCCTTAGTACTCGTTCTTGGCCATTTCATGTTGCACACA

Reverse complement sequence

TGTGTGCAACATGAAATGGCCAAGAACGAGTACTAAGGGTGTATTTGAGGAGAAGGGGATTGAGGAGATTAGGAGGATACGCAAAACGAGGTGAGCTATT[T/A]
GCTCATGATTAATTGAGTATTAACTATTTTAAATTTAAAAAATGGATTAATATGATTTTTTTAAAGCAAATTTCCTATAGAAAATTTTTACAAAAAACAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	43.60%	1.71%	0.32%	NA
All Indica	2759	79.40%	19.50%	1.09%	0.00%	NA
All Japonica	1512	1.60%	94.20%	3.17%	0.99%	NA
Aus	269	81.80%	18.20%	0.00%	0.00%	NA
Indica I	595	60.20%	38.80%	1.01%	0.00%	NA
Indica II	465	94.00%	4.30%	1.72%	0.00%	NA
Indica III	913	78.20%	21.10%	0.66%	0.00%	NA
Indica Intermediate	786	86.80%	12.00%	1.27%	0.00%	NA
Temperate Japonica	767	0.70%	97.00%	2.35%	0.00%	NA
Tropical Japonica	504	2.00%	95.40%	1.39%	1.19%	NA
Japonica Intermediate	241	3.70%	83.00%	9.54%	3.73%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	42.20%	54.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202764681	A -> T	LOC_Os02g05650.1	upstream_gene_variant ; 1799.0bp to feature; MODIFIER	silent_mutation	Average:65.027; most accessible tissue: Minghui63 flower, score: 82.891	N	N	N	N
vg0202764681	A -> T	LOC_Os02g05660.1	downstream_gene_variant ; 1536.0bp to feature; MODIFIER	silent_mutation	Average:65.027; most accessible tissue: Minghui63 flower, score: 82.891	N	N	N	N
vg0202764681	A -> T	LOC_Os02g05650-LOC_Os02g05660	intergenic_region ; MODIFIER	silent_mutation	Average:65.027; most accessible tissue: Minghui63 flower, score: 82.891	N	N	N	N
vg0202764681	A -> DEL	N	N	silent_mutation	Average:65.027; most accessible tissue: Minghui63 flower, score: 82.891	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202764681	8.66E-06	8.66E-06	mr1598	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202764681	4.69E-06	8.81E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202764681	NA	2.66E-09	mr1761	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202764681	1.02E-06	1.02E-06	mr1795	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202764681	NA	2.33E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202764681	NA	4.76E-18	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251