| Variant ID: vg0202629950 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2629950 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 236. )
TTAAATCTGTAGTTTTGTGATGTATTGTGCAAAGTACCTGTAGTTTTGTGATAAACGTAGACACTAAATCTGTAGTTTTGTGAAATATATTCTTAAATAT[A/G]
TAGTTTTGTGATAGAATGTACAAAATATATGCAGTTTTATGAAATTTACTCGATTTCTGTATACATAAATCTCTCTCACTAGACGTAGGAGTAAAACTCT
AGAGTTTTACTCCTACGTCTAGTGAGAGAGATTTATGTATACAGAAATCGAGTAAATTTCATAAAACTGCATATATTTTGTACATTCTATCACAAAACTA[T/C]
ATATTTAAGAATATATTTCACAAAACTACAGATTTAGTGTCTACGTTTATCACAAAACTACAGGTACTTTGCACAATACATCACAAAACTACAGATTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 4.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 54.60% | 45.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 3.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.30% | 4.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 24.10% | 75.50% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.60% | 32.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202629950 | A -> G | LOC_Os02g05450.1 | downstream_gene_variant ; 3640.0bp to feature; MODIFIER | silent_mutation | Average:59.846; most accessible tissue: Callus, score: 88.572 | N | N | N | N |
| vg0202629950 | A -> G | LOC_Os02g05460.1 | downstream_gene_variant ; 1790.0bp to feature; MODIFIER | silent_mutation | Average:59.846; most accessible tissue: Callus, score: 88.572 | N | N | N | N |
| vg0202629950 | A -> G | LOC_Os02g05450-LOC_Os02g05460 | intergenic_region ; MODIFIER | silent_mutation | Average:59.846; most accessible tissue: Callus, score: 88.572 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202629950 | NA | 1.34E-17 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0202629950 | NA | 6.55E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0202629950 | NA | 3.05E-06 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202629950 | NA | 9.95E-06 | mr1051 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202629950 | NA | 1.12E-07 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202629950 | NA | 1.26E-11 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202629950 | NA | 4.42E-09 | mr1164 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202629950 | NA | 5.91E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202629950 | NA | 9.36E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202629950 | NA | 7.32E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/