\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202453103:

Variant ID: vg0202453103 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2453103
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGTGGATGGATGCAGAGACAAAGGATTTAGACAGGTTCAGGCCCTCTCAATGAGAGGTAATACCCTACTCCTGTTTGGGGATTTGAATCCGCCGGGT[A/G]
TGTATTGATCTGACGATCAGGTTGTGTCATCTATGCCCCCTAGAGGGCCTCCTGCCCACCTTATATAGGATGGGGGGCAGGATTACAAGATAGAAACCTT

Reverse complement sequence

AAGGTTTCTATCTTGTAATCCTGCCCCCCATCCTATATAAGGTGGGCAGGAGGCCCTCTAGGGGGCATAGATGACACAACCTGATCGTCAGATCAATACA[T/C]
ACCCGGCGGATTCAAATCCCCAAACAGGAGTAGGGTATTACCTCTCATTGAGAGGGCCTGAACCTGTCTAAATCCTTTGTCTCTGCATCCATCCACTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 11.00% 7.30% 9.23% 72.56% NA
All Indica  2759 0.70% 0.40% 10.62% 88.29% NA
All Japonica  1512 31.90% 21.00% 7.47% 39.62% NA
Aus  269 0.00% 3.70% 5.20% 91.08% NA
Indica I  595 0.50% 0.20% 6.55% 92.77% NA
Indica II  465 1.50% 0.40% 4.73% 93.33% NA
Indica III  913 0.20% 0.40% 16.76% 82.58% NA
Indica Intermediate  786 1.00% 0.40% 10.05% 88.55% NA
Temperate Japonica  767 55.40% 28.90% 7.43% 8.21% NA
Tropical Japonica  504 4.60% 6.00% 4.76% 84.72% NA
Japonica Intermediate  241 14.10% 27.40% 13.28% 45.23% NA
VI/Aromatic  96 0.00% 0.00% 8.33% 91.67% NA
Intermediate  90 17.80% 5.60% 8.89% 67.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202453103 A -> G LOC_Os02g05130.1 downstream_gene_variant ; 514.0bp to feature; MODIFIER silent_mutation Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0202453103 A -> G LOC_Os02g05130-LOC_Os02g05140 intergenic_region ; MODIFIER silent_mutation Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0202453103 A -> DEL N N silent_mutation Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202453103 NA 8.10E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103 NA 2.47E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103 NA 3.23E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103 NA 6.59E-08 mr1606_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103 NA 4.34E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103 NA 3.96E-10 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103 NA 9.17E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103 NA 3.02E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251