\
| Variant ID: vg0202453103 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2453103 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 100. )
AAAAGTGGATGGATGCAGAGACAAAGGATTTAGACAGGTTCAGGCCCTCTCAATGAGAGGTAATACCCTACTCCTGTTTGGGGATTTGAATCCGCCGGGT[A/G]
TGTATTGATCTGACGATCAGGTTGTGTCATCTATGCCCCCTAGAGGGCCTCCTGCCCACCTTATATAGGATGGGGGGCAGGATTACAAGATAGAAACCTT
AAGGTTTCTATCTTGTAATCCTGCCCCCCATCCTATATAAGGTGGGCAGGAGGCCCTCTAGGGGGCATAGATGACACAACCTGATCGTCAGATCAATACA[T/C]
ACCCGGCGGATTCAAATCCCCAAACAGGAGTAGGGTATTACCTCTCATTGAGAGGGCCTGAACCTGTCTAAATCCTTTGTCTCTGCATCCATCCACTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 11.00% | 7.30% | 9.23% | 72.56% | NA |
| All Indica | 2759 | 0.70% | 0.40% | 10.62% | 88.29% | NA |
| All Japonica | 1512 | 31.90% | 21.00% | 7.47% | 39.62% | NA |
| Aus | 269 | 0.00% | 3.70% | 5.20% | 91.08% | NA |
| Indica I | 595 | 0.50% | 0.20% | 6.55% | 92.77% | NA |
| Indica II | 465 | 1.50% | 0.40% | 4.73% | 93.33% | NA |
| Indica III | 913 | 0.20% | 0.40% | 16.76% | 82.58% | NA |
| Indica Intermediate | 786 | 1.00% | 0.40% | 10.05% | 88.55% | NA |
| Temperate Japonica | 767 | 55.40% | 28.90% | 7.43% | 8.21% | NA |
| Tropical Japonica | 504 | 4.60% | 6.00% | 4.76% | 84.72% | NA |
| Japonica Intermediate | 241 | 14.10% | 27.40% | 13.28% | 45.23% | NA |
| VI/Aromatic | 96 | 0.00% | 0.00% | 8.33% | 91.67% | NA |
| Intermediate | 90 | 17.80% | 5.60% | 8.89% | 67.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202453103 | A -> G | LOC_Os02g05130.1 | downstream_gene_variant ; 514.0bp to feature; MODIFIER | silent_mutation | Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0202453103 | A -> G | LOC_Os02g05130-LOC_Os02g05140 | intergenic_region ; MODIFIER | silent_mutation | Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0202453103 | A -> DEL | N | N | silent_mutation | Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202453103 | NA | 8.10E-08 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202453103 | NA | 2.47E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202453103 | NA | 3.23E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202453103 | NA | 6.59E-08 | mr1606_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202453103 | NA | 4.34E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202453103 | NA | 3.96E-10 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202453103 | NA | 9.17E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202453103 | NA | 3.02E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |