Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200563959:

Variant ID: vg0200563959 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 563959
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.11, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTAGGCGGCGATGAGGGCGGCGACGGTGGCCTCCTCGGGGGCGATGGAGAAGGAGGGCATGGTGTCGAGGAGGATGCAGCGGGCGTGGTTGAGCATGC[G/T]
GTGGGAGGCGAGGATCGGGATGAGGAGGGAGAAGGTGGCTGGCTCGGGGCTGAAGCCGGCGCGACGGTAGGCGAAGCGGAAGAACTGGAGGGCGAGGTCG

Reverse complement sequence

CGACCTCGCCCTCCAGTTCTTCCGCTTCGCCTACCGTCGCGCCGGCTTCAGCCCCGAGCCAGCCACCTTCTCCCTCCTCATCCCGATCCTCGCCTCCCAC[C/A]
GCATGCTCAACCACGCCCGCTGCATCCTCCTCGACACCATGCCCTCCTTCTCCATCGCCCCCGAGGAGGCCACCGTCGCCGCCCTCATCGCCGCCTACGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.20% 0.25% 0.00% NA
All Indica  2759 25.40% 74.20% 0.43% 0.00% NA
All Japonica  1512 95.70% 4.30% 0.00% 0.00% NA
Aus  269 66.50% 33.50% 0.00% 0.00% NA
Indica I  595 45.70% 53.10% 1.18% 0.00% NA
Indica II  465 26.70% 73.10% 0.22% 0.00% NA
Indica III  913 12.00% 87.80% 0.11% 0.00% NA
Indica Intermediate  786 24.70% 74.90% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 93.30% 6.70% 0.00% 0.00% NA
Japonica Intermediate  241 88.80% 11.20% 0.00% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200563959 G -> T LOC_Os02g02020.1 missense_variant ; p.Arg150Ser; MODERATE nonsynonymous_codon ; R150S Average:91.9; most accessible tissue: Zhenshan97 panicle, score: 95.323 benign 0.193 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200563959 G T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200563959 NA 2.44E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251