Search for Variation information by Variation ID:
Detailed information for vg0200562672:
| Variant ID: vg0200562672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 562672 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 336. )
Flanking Sequence (100 bp) in Reference Genome:
AAGAGAGCTTCCAGAATCTTATGAGCCATGTCCATGTTCTCTGTAACCCCCTTCTCAATCATACTCTTCATAACCCTGCTAGCAGTCTGAACCCGGCCAC[T/C]
GTTGAAAAGCGCTACCATGACAGACATGAACAGGGATGGGCTCGGTACATGCCCTTGTTCCATCATACTGTCAAGTGCCGTCTTTGCATCAGCTGGCTCA
Reverse complement sequence
TGAGCCAGCTGATGCAAAGACGGCACTTGACAGTATGATGGAACAAGGGCATGTACCGAGCCCATCCCTGTTCATGTCTGTCATGGTAGCGCTTTTCAAC[A/G]
GTGGCCGGGTTCAGACTGCTAGCAGGGTTATGAAGAGTATGATTGAGAAGGGGGTTACAGAGAACATGGACATGGCTCATAAGATTCTGGAAGCTCTCTT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 39.40% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 8.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 79.10% | 20.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200562672 | T -> C | LOC_Os02g02020.1 | missense_variant ; p.Ser579Gly; MODERATE | nonsynonymous_codon ; S579G | Average:71.386; most accessible tissue: Zhenshan97 young leaf, score: 84.624 | benign  |
-1.051 |
TOLERATED | 0.08 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200562672 | NA | 3.03E-09 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 2.22E-09 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 9.12E-19 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 2.53E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 5.13E-08 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 2.62E-21 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 1.30E-12 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 6.17E-15 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 6.47E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200562672 | NA | 7.57E-07 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |