| Variant ID: vg0141857437 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41857437 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.03, others allele: 0.00, population size: 268. )
AGTAGTAGTAGTAGTAGTACCGACTTGCATAATAGTTAACGAAGTTGATTGATAGTACAGTTAACGATTATTCCGGCCCTGTACGTGCCAACGAACAAAA[A/T]
GATGATCACCAATGAGATCAGTGCCATTGTCGTTCTTCCATATGGACAAATGCTACTACATTCTCAATGCTCAGGCACAAGAATTGAGCTTGCCCTGTGA
TCACAGGGCAAGCTCAATTCTTGTGCCTGAGCATTGAGAATGTAGTAGCATTTGTCCATATGGAAGAACGACAATGGCACTGATCTCATTGGTGATCATC[T/A]
TTTTGTTCGTTGGCACGTACAGGGCCGGAATAATCGTTAACTGTACTATCAATCAACTTCGTTAACTATTATGCAAGTCGGTACTACTACTACTACTACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.00% | 32.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 46.00% | 53.90% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 21.00% | 79.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 45.90% | 53.80% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 47.60% | 52.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141857437 | A -> T | LOC_Os01g72190.1 | upstream_gene_variant ; 4125.0bp to feature; MODIFIER | silent_mutation | Average:73.445; most accessible tissue: Callus, score: 96.711 | N | N | N | N |
| vg0141857437 | A -> T | LOC_Os01g72170.1 | downstream_gene_variant ; 2554.0bp to feature; MODIFIER | silent_mutation | Average:73.445; most accessible tissue: Callus, score: 96.711 | N | N | N | N |
| vg0141857437 | A -> T | LOC_Os01g72170-LOC_Os01g72190 | intergenic_region ; MODIFIER | silent_mutation | Average:73.445; most accessible tissue: Callus, score: 96.711 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141857437 | NA | 9.11E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 1.05E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 8.61E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 1.12E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 4.94E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 3.25E-08 | mr1215 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 2.97E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 9.52E-06 | mr1254 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 3.46E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141857437 | NA | 8.30E-09 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/