\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141857437:

Variant ID: vg0141857437 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41857437
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.03, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAGTAGTAGTAGTAGTACCGACTTGCATAATAGTTAACGAAGTTGATTGATAGTACAGTTAACGATTATTCCGGCCCTGTACGTGCCAACGAACAAAA[A/T]
GATGATCACCAATGAGATCAGTGCCATTGTCGTTCTTCCATATGGACAAATGCTACTACATTCTCAATGCTCAGGCACAAGAATTGAGCTTGCCCTGTGA

Reverse complement sequence

TCACAGGGCAAGCTCAATTCTTGTGCCTGAGCATTGAGAATGTAGTAGCATTTGTCCATATGGAAGAACGACAATGGCACTGATCTCATTGGTGATCATC[T/A]
TTTTGTTCGTTGGCACGTACAGGGCCGGAATAATCGTTAACTGTACTATCAATCAACTTCGTTAACTATTATGCAAGTCGGTACTACTACTACTACTACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 32.90% 0.08% 0.00% NA
All Indica  2759 46.00% 53.90% 0.14% 0.00% NA
All Japonica  1512 96.80% 3.20% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 21.00% 79.00% 0.00% 0.00% NA
Indica II  465 75.50% 24.50% 0.00% 0.00% NA
Indica III  913 45.90% 53.80% 0.33% 0.00% NA
Indica Intermediate  786 47.60% 52.30% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 91.50% 8.50% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141857437 A -> T LOC_Os01g72190.1 upstream_gene_variant ; 4125.0bp to feature; MODIFIER silent_mutation Average:73.445; most accessible tissue: Callus, score: 96.711 N N N N
vg0141857437 A -> T LOC_Os01g72170.1 downstream_gene_variant ; 2554.0bp to feature; MODIFIER silent_mutation Average:73.445; most accessible tissue: Callus, score: 96.711 N N N N
vg0141857437 A -> T LOC_Os01g72170-LOC_Os01g72190 intergenic_region ; MODIFIER silent_mutation Average:73.445; most accessible tissue: Callus, score: 96.711 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141857437 NA 9.11E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 1.05E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 8.61E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 1.12E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 4.94E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 3.25E-08 mr1215 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 2.97E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 9.52E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 3.46E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 8.30E-09 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 3.53E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 2.54E-08 mr1511 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 5.31E-06 NA mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 8.49E-06 3.10E-07 mr1520 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 4.65E-15 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 8.83E-06 1.01E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 1.74E-06 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 8.19E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 4.70E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 7.91E-06 mr1789 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 4.88E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141857437 NA 8.52E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251