Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139482305:

Variant ID: vg0139482305 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 39482305
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACATATGGTGGGCTGTGGGTGCATGGTTTTGATGGTCGCGCCCATGGTACTTAAGGACCGGTTCGCGGGAAACCCTGAAAGAATTCCTCGTACTTGCCA[C/A]
AAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTTTAGCTGATGCATCTAGGCAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGAC

Reverse complement sequence

GTCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTGCCTAGATGCATCAGCTAAAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTT[G/T]
TGGCAAGTACGAGGAATTCTTTCAGGGTTTCCCGCGAACCGGTCCTTAAGTACCATGGGCGCGACCATCAAAACCATGCACCCACAGCCCACCATATGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	1.10%	1.08%	0.87%	NA
All Indica	2759	99.70%	0.00%	0.14%	0.07%	NA
All Japonica	1512	91.90%	3.40%	3.04%	1.59%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	99.50%	0.20%	0.34%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.60%	0.00%	0.13%	0.25%	NA
Temperate Japonica	767	88.00%	6.80%	5.22%	0.00%	NA
Tropical Japonica	504	94.60%	0.00%	1.19%	4.17%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	84.40%	0.00%	1.04%	14.58%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139482305	C -> A	LOC_Os01g67930.1	upstream_gene_variant ; 3643.0bp to feature; MODIFIER	silent_mutation	Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482305	C -> A	LOC_Os01g67940.1	upstream_gene_variant ; 1252.0bp to feature; MODIFIER	silent_mutation	Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482305	C -> A	LOC_Os01g67950.1	upstream_gene_variant ; 1450.0bp to feature; MODIFIER	silent_mutation	Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482305	C -> A	LOC_Os01g67960.1	upstream_gene_variant ; 4627.0bp to feature; MODIFIER	silent_mutation	Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482305	C -> A	LOC_Os01g67940-LOC_Os01g67950	intergenic_region ; MODIFIER	silent_mutation	Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482305	C -> DEL	N	N	silent_mutation	Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139482305	NA	3.94E-08	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482305	1.19E-08	1.19E-08	mr1369	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482305	2.96E-06	5.95E-09	mr1453	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482305	NA	3.07E-09	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482305	NA	3.72E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251