Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138753405:

Variant ID: vg0138753405 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 38753405
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GCATGATAATTTTTCACAAGAAAGGCTTGTGTGCCATTTGTGTGGTTCCGGGAAATATAGTGTGTTTTACTCTTGGTAGTTCTAGTGAATTGACAATGGT[G/A]
TGATGTAACTAGTTTTTGGCTAGGGAAAAGTGAAGTGCTTCTATTTCATAGTTTTCGTACTGAATGGAAAATATTTAGTTACATACTGATATATGAATCT

Reverse complement sequence

AGATTCATATATCAGTATGTAACTAAATATTTTCCATTCAGTACGAAAACTATGAAATAGAAGCACTTCACTTTTCCCTAGCCAAAAACTAGTTACATCA[C/T]
ACCATTGTCAATTCACTAGAACTACCAAGAGTAAAACACACTATATTTCCCGGAACCACACAAATGGCACACAAGCCTTTCTTGTGAAAAATTATCATGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.40%	39.60%	0.02%	0.00%	NA
All Indica	2759	96.50%	3.50%	0.04%	0.00%	NA
All Japonica	1512	6.90%	93.10%	0.00%	0.00%	NA
Aus	269	12.60%	87.40%	0.00%	0.00%	NA
Indica I	595	94.60%	5.20%	0.17%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	96.20%	3.80%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	3.30%	0.00%	0.00%	NA
Temperate Japonica	767	2.90%	97.10%	0.00%	0.00%	NA
Tropical Japonica	504	13.90%	86.10%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	53.30%	46.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0138753405	G -> A	LOC_Os01g66710.1	downstream_gene_variant ; 2637.0bp to feature; MODIFIER	silent_mutation	Average:39.282; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0138753405	G -> A	LOC_Os01g66730.1	downstream_gene_variant ; 1653.0bp to feature; MODIFIER	silent_mutation	Average:39.282; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0138753405	G -> A	LOC_Os01g66730.2	downstream_gene_variant ; 1681.0bp to feature; MODIFIER	silent_mutation	Average:39.282; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0138753405	G -> A	LOC_Os01g66720.1	intron_variant ; MODIFIER	silent_mutation	Average:39.282; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0138753405	NA	1.17E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	3.26E-43	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	8.56E-12	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	2.26E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	4.27E-24	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	7.56E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	1.20E-50	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	2.93E-32	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	3.17E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	2.87E-16	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	9.26E-07	mr1946_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138753405	NA	9.26E-07	mr1948_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251