Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137837960:

Variant ID: vg0137837960 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37837960
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACAGATTATTTTTCGTTTGCAAATATGTCGTTTGGTTTTTTCCCTGAATAAGCCAACCAAGTATGTAAGTATGTATAATCTTAGGACGTGTTCACTTT[G/A]
ATGCCATTTTAACCTTACCAAATTTTAGTAAAGTTAAAAAAAAAATAGCTACATTTAGTTTGTTATCAAATTTTGGTAACTGTATAAGAAATTCTACTAA

Reverse complement sequence

TTAGTAGAATTTCTTATACAGTTACCAAAATTTGATAACAAACTAAATGTAGCTATTTTTTTTTTAACTTTACTAAAATTTGGTAAGGTTAAAATGGCAT[C/T]
AAAGTGAACACGTCCTAAGATTATACATACTTACATACTTGGTTGGCTTATTCAGGGAAAAAACCAAACGACATATTTGCAAACGAAAAATAATCTGTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 35.20% 0.08% 0.00% NA
All Indica  2759 98.20% 1.70% 0.07% 0.00% NA
All Japonica  1512 2.50% 97.40% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.70% 0.13% 0.00% NA
Temperate Japonica  767 2.30% 97.50% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 44.40% 54.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137837960 G -> A LOC_Os01g65200.3 downstream_gene_variant ; 1034.0bp to feature; MODIFIER silent_mutation Average:39.792; most accessible tissue: Minghui63 flower, score: 85.386 N N N N
vg0137837960 G -> A LOC_Os01g65200.1 downstream_gene_variant ; 1034.0bp to feature; MODIFIER silent_mutation Average:39.792; most accessible tissue: Minghui63 flower, score: 85.386 N N N N
vg0137837960 G -> A LOC_Os01g65200.2 downstream_gene_variant ; 1034.0bp to feature; MODIFIER silent_mutation Average:39.792; most accessible tissue: Minghui63 flower, score: 85.386 N N N N
vg0137837960 G -> A LOC_Os01g65210.1 intron_variant ; MODIFIER silent_mutation Average:39.792; most accessible tissue: Minghui63 flower, score: 85.386 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0137837960 G A -0.04 -0.04 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137837960 NA 6.89E-111 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 7.31E-109 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 1.71E-74 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.28E-81 mr1015 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 6.45E-29 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 3.47E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 9.23E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 5.81E-32 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 7.08E-45 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 5.01E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 6.65E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 6.70E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 4.90E-10 3.92E-104 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 7.23E-07 2.77E-11 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 8.17E-15 3.94E-104 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 1.82E-07 4.73E-11 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 1.44E-46 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 9.27E-52 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 3.19E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 3.20E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 5.06E-30 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 7.98E-09 3.86E-33 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 3.13E-08 3.13E-08 mr1375 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 1.68E-10 1.77E-114 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 4.64E-06 9.71E-11 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 4.17E-12 1.26E-113 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 4.86E-06 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 4.92E-11 1.77E-87 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 1.04E-06 1.18E-11 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 3.77E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 1.12E-07 4.32E-44 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 1.22E-10 8.88E-105 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 5.06E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 1.04E-25 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 3.25E-88 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.86E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.03E-99 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 7.03E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 1.92E-113 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 1.83E-90 mr1015_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 4.63E-26 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.50E-81 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.06E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.26E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 7.85E-41 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 7.70E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 6.67E-10 1.99E-116 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 1.20E-09 1.02E-20 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 5.55E-42 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.73E-51 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 8.68E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 4.46E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.18E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 1.26E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 5.50E-11 8.96E-108 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 1.58E-10 1.28E-21 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 1.26E-18 4.68E-177 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 5.61E-08 2.27E-12 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 8.99E-15 5.63E-134 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 2.63E-08 1.45E-15 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.31E-41 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 6.03E-13 2.44E-61 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 2.21E-07 2.21E-07 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 2.18E-10 1.03E-140 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837960 NA 2.89E-08 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251