Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137837368:

Variant ID: vg0137837368 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 37837368
Reference Allele: CAlternative Allele: CT,CTT
Primary Allele: CSecondary Allele: CT

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCGTCGACCACCTCGGCGGCCCGGCCTCCCGCGGCAGCTCCGGCCGGTGGCCCGCCGCGTTCTTCCTCATCGGTACGTACGTTCGCCGCCGCCTTATC[C/CT,CTT]
TTTTTTTTTTGGAAAAAGAAAAGAAGAGAAAAAAAAAGTAGCATGTAACGAGGCGTGTTGTGTTGTGAGGTGCAGGAGCGGAGGTAGGCGAGAGGTTCGC

Reverse complement sequence

GCGAACCTCTCGCCTACCTCCGCTCCTGCACCTCACAACACAACACGCCTCGTTACATGCTACTTTTTTTTTCTCTTCTTTTCTTTTTCCAAAAAAAAAA[G/AG,AAG]
GATAAGGCGGCGGCGAACGTACGTACCGATGAGGAAGAACGCGGCGGGCCACCGGCCGGAGCTGCCGCGGGAGGCCGGGCCGCCGAGGTGGTCGACGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 21.40% 1.12% 0.08% CTT: 0.02%
All Indica  2759 68.90% 29.50% 1.49% 0.14% CTT: 0.04%
All Japonica  1512 99.00% 0.50% 0.46% 0.00% NA
Aus  269 31.20% 66.90% 1.86% 0.00% NA
Indica I  595 63.70% 31.40% 4.71% 0.17% NA
Indica II  465 84.90% 14.40% 0.65% 0.00% NA
Indica III  913 58.80% 40.70% 0.11% 0.22% CTT: 0.11%
Indica Intermediate  786 74.90% 23.80% 1.15% 0.13% NA
Temperate Japonica  767 98.40% 0.70% 0.91% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137837368 C -> CTT LOC_Os01g65190.1 downstream_gene_variant ; 4988.0bp to feature; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CTT LOC_Os01g65200.3 downstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CTT LOC_Os01g65200.1 downstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CTT LOC_Os01g65200.2 downstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CTT LOC_Os01g65210.1 intron_variant ; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> DEL N N silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CT LOC_Os01g65190.1 downstream_gene_variant ; 4988.0bp to feature; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CT LOC_Os01g65200.3 downstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CT LOC_Os01g65200.1 downstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CT LOC_Os01g65200.2 downstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N
vg0137837368 C -> CT LOC_Os01g65210.1 intron_variant ; MODIFIER silent_mutation Average:85.218; most accessible tissue: Minghui63 flower, score: 90.298 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0137837368 C CT 0.04 0.11 0.21 0.03 0.07 0.12
vg0137837368 C CTT 0.17 0.25 0.36 0.05 0.13 0.28