Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137834291:

Variant ID: vg0137834291 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 37834291
Reference Allele: TCGGCCGTCAlternative Allele: T
Primary Allele: TCGGCCGTCSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGAAGAGGAAAAAATATCTGAACGGGACGGCGACCGAGCCACCATGGACGCGGGGGCGGAGCCCCTCCTGCCGCCGCCGGCTTCCGCGGTGGACCACC[TCGGCCGTC/T]
CGGCCTCCCGCCGCACCTCCGGCCGGTGGCTCGCCGCCCTCTTCATCATCGGTACCTCCAAAAAACTCCCCCCGAGAAACCAGGGCGGCGGCGGCGGCGG

Reverse complement sequence

CCGCCGCCGCCGCCGCCCTGGTTTCTCGGGGGGAGTTTTTTGGAGGTACCGATGATGAAGAGGGCGGCGAGCCACCGGCCGGAGGTGCGGCGGGAGGCCG[GACGGCCGA/A]
GGTGGTCCACCGCGGAAGCCGGCGGCGGCAGGAGGGGCTCCGCCCCCGCGTCCATGGTGGCTCGGTCGCCGTCCCGTTCAGATATTTTTTCCTCTTCTCA

Allele Frequencies:

Populations Population SizeFrequency of TCGGCCGTC(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 30.90% 9.27% 2.24% NA
All Indica  2759 33.70% 48.80% 14.21% 3.30% NA
All Japonica  1512 95.50% 1.80% 2.05% 0.66% NA
Aus  269 71.00% 22.70% 4.83% 1.49% NA
Indica I  595 37.30% 41.70% 19.83% 1.18% NA
Indica II  465 15.30% 75.30% 8.39% 1.08% NA
Indica III  913 42.50% 39.20% 11.94% 6.35% NA
Indica Intermediate  786 31.70% 49.60% 16.03% 2.67% NA
Temperate Japonica  767 94.10% 2.00% 3.00% 0.91% NA
Tropical Japonica  504 97.40% 1.60% 0.60% 0.40% NA
Japonica Intermediate  241 95.90% 1.70% 2.07% 0.41% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137834291 TCGGCCGTC -> T LOC_Os01g65200.3 frameshift_variant ; p.Arg21fs; HIGH frameshift_variant Average:89.315; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0137834291 TCGGCCGTC -> T LOC_Os01g65200.1 frameshift_variant ; p.Arg21fs; HIGH frameshift_variant Average:89.315; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0137834291 TCGGCCGTC -> T LOC_Os01g65200.2 frameshift_variant ; p.Arg21fs; HIGH frameshift_variant Average:89.315; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0137834291 TCGGCCGTC -> DEL LOC_Os01g65200.3 N frameshift_variant Average:89.315; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0137834291 TCGGCCGTC -> DEL LOC_Os01g65200.1 N frameshift_variant Average:89.315; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0137834291 TCGGCCGTC -> DEL LOC_Os01g65200.2 N frameshift_variant Average:89.315; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0137834291 TCGGC* T 0.13 0.06 0.02 0.04 0.05 0.05