Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137237085:

Variant ID: vg0137237085 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37237085
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TCCATATAATATAGATGTGGAAAATGATAGAATGACTTACATTATGAAACGGATATTTGAGTATATATGTAGCACAGTGATGTGTAGGAGCATGTGTTGA[T/C]
TGCTTTCGGTTACCGGTCAGACGTTTAGACCGTAGCTTACCATTGCCCCCAGTTTAATTTCATTCGTTCGCCACTGTCGTTTATATGAAGAATAAAAAAA

Reverse complement sequence

TTTTTTTATTCTTCATATAAACGACAGTGGCGAACGAATGAAATTAAACTGGGGGCAATGGTAAGCTACGGTCTAAACGTCTGACCGGTAACCGAAAGCA[A/G]
TCAACACATGCTCCTACACATCACTGTGCTACATATATACTCAAATATCCGTTTCATAATGTAAGTCATTCTATCATTTTCCACATCTATATTATATGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.10%	44.80%	0.17%	0.00%	NA
All Indica	2759	27.60%	72.10%	0.25%	0.00%	NA
All Japonica	1512	98.00%	2.00%	0.00%	0.00%	NA
Aus	269	74.70%	25.30%	0.00%	0.00%	NA
Indica I	595	2.00%	97.60%	0.34%	0.00%	NA
Indica II	465	15.50%	84.10%	0.43%	0.00%	NA
Indica III	913	44.50%	55.40%	0.11%	0.00%	NA
Indica Intermediate	786	34.60%	65.10%	0.25%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137237085	T -> C	LOC_Os01g64100.1	3_prime_UTR_variant ; 260.0bp to feature; MODIFIER	silent_mutation	Average:64.775; most accessible tissue: Minghui63 root, score: 82.02	N	N	N	N
vg0137237085	T -> C	LOC_Os01g64110.1	upstream_gene_variant ; 1816.0bp to feature; MODIFIER	silent_mutation	Average:64.775; most accessible tissue: Minghui63 root, score: 82.02	N	N	N	N
vg0137237085	T -> C	LOC_Os01g64120.1	upstream_gene_variant ; 4070.0bp to feature; MODIFIER	silent_mutation	Average:64.775; most accessible tissue: Minghui63 root, score: 82.02	N	N	N	N
vg0137237085	T -> C	LOC_Os01g64090.1	downstream_gene_variant ; 2710.0bp to feature; MODIFIER	silent_mutation	Average:64.775; most accessible tissue: Minghui63 root, score: 82.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137237085	NA	3.28E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	8.55E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	2.56E-33	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	1.08E-15	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	2.14E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	6.24E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	7.64E-20	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	2.86E-16	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	1.49E-13	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	5.15E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237085	NA	2.12E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251