Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137237028:

Variant ID: vg0137237028 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37237028
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TTTATAATACTTCCTCCGTTCCATAATGTACATTATGTTATTCTAGCATTTTCTATATCCATATAATATAGATGTGGAAAATGATAGAATGACTTACATT[A/G]
TGAAACGGATATTTGAGTATATATGTAGCACAGTGATGTGTAGGAGCATGTGTTGATTGCTTTCGGTTACCGGTCAGACGTTTAGACCGTAGCTTACCAT

Reverse complement sequence

ATGGTAAGCTACGGTCTAAACGTCTGACCGGTAACCGAAAGCAATCAACACATGCTCCTACACATCACTGTGCTACATATATACTCAAATATCCGTTTCA[T/C]
AATGTAAGTCATTCTATCATTTTCCACATCTATATTATATGGATATAGAAAATGCTAGAATAACATAATGTACATTATGGAACGGAGGAAGTATTATAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.80%	5.20%	0.00%	0.00%	NA
All Indica	2759	98.50%	1.50%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	25.70%	74.30%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137237028	A -> G	LOC_Os01g64100.1	3_prime_UTR_variant ; 203.0bp to feature; MODIFIER	silent_mutation	Average:74.861; most accessible tissue: Callus, score: 91.532	N	N	N	N
vg0137237028	A -> G	LOC_Os01g64110.1	upstream_gene_variant ; 1873.0bp to feature; MODIFIER	silent_mutation	Average:74.861; most accessible tissue: Callus, score: 91.532	N	N	N	N
vg0137237028	A -> G	LOC_Os01g64120.1	upstream_gene_variant ; 4127.0bp to feature; MODIFIER	silent_mutation	Average:74.861; most accessible tissue: Callus, score: 91.532	N	N	N	N
vg0137237028	A -> G	LOC_Os01g64090.1	downstream_gene_variant ; 2653.0bp to feature; MODIFIER	silent_mutation	Average:74.861; most accessible tissue: Callus, score: 91.532	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137237028	NA	1.52E-17	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	2.58E-16	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	2.77E-37	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	1.18E-44	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	6.00E-38	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	1.52E-11	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	4.77E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	4.25E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	6.70E-46	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137237028	NA	1.07E-28	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251