Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135984153:

Variant ID: vg0135984153 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35984153
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

GTCGATCTTGGCTGTAATCGAGCACAGTAACCATGTAGCAACATGTTTCTGCTCAAAGACGAGCCAGTTTCCAAATTGTCTTCAGTATACAGCCGCCATG[T/A]
TTTGACGTAGTACTACATACATTTACTTCGGCCTGGTTTGGAATTTGAATGGTATTCTTTATAGCTAAGTTGCTTAATAATGTTTGACTAATTTCAGAAT

Reverse complement sequence

ATTCTGAAATTAGTCAAACATTATTAAGCAACTTAGCTATAAAGAATACCATTCAAATTCCAAACCAGGCCGAAGTAAATGTATGTAGTACTACGTCAAA[A/T]
CATGGCGGCTGTATACTGAAGACAATTTGGAAACTGGCTCGTCTTTGAGCAGAAACATGTTGCTACATGGTTACTGTGCTCGATTACAGCCAAGATCGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	47.70%	0.21%	0.02%	NA
All Indica	2759	26.10%	73.60%	0.33%	0.00%	NA
All Japonica	1512	98.20%	1.80%	0.00%	0.00%	NA
Aus	269	41.60%	58.40%	0.00%	0.00%	NA
Indica I	595	11.10%	88.60%	0.34%	0.00%	NA
Indica II	465	6.50%	93.50%	0.00%	0.00%	NA
Indica III	913	39.50%	60.40%	0.11%	0.00%	NA
Indica Intermediate	786	33.50%	65.80%	0.76%	0.00%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	7.30%	1.04%	0.00%	NA
Intermediate	90	63.30%	35.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135984153	T -> A	LOC_Os01g62160.1	3_prime_UTR_variant ; 234.0bp to feature; MODIFIER	silent_mutation	Average:67.233; most accessible tissue: Zhenshan97 flower, score: 83.392	N	N	N	N
vg0135984153	T -> DEL	N	N	silent_mutation	Average:67.233; most accessible tissue: Zhenshan97 flower, score: 83.392	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135984153	NA	1.45E-09	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135984153	NA	7.16E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135984153	NA	1.66E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135984153	NA	2.60E-08	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135984153	NA	1.14E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135984153	NA	8.26E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251