Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134962845:

Variant ID: vg0134962845 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34962845
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TTGAGCCCATTGTTGTCCATGGCCTTGGTGCTCGCTAGCTTCCTGCACACACACAAGAAAGAAACACCCACCATGCGACGTGAGCAGAGGATTTCTGGTG[G/A]
CTAATTGATGGAGTCTCGCTCATGGAGGAGTACTCACTTCCTCTCCTCGAGGAAGAAGTCCTTGAAGAGCTTGAGGCGGGTCTCCTTGACCTCCTCGCAG

Reverse complement sequence

CTGCGAGGAGGTCAAGGAGACCCGCCTCAAGCTCTTCAAGGACTTCTTCCTCGAGGAGAGGAAGTGAGTACTCCTCCATGAGCGAGACTCCATCAATTAG[C/T]
CACCAGAAATCCTCTGCTCACGTCGCATGGTGGGTGTTTCTTTCTTGTGTGTGTGCAGGAAGCTAGCGAGCACCAAGGCCATGGACAACAATGGGCTCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	11.40%	0.02%	0.23%	NA
All Indica	2759	80.20%	19.40%	0.04%	0.40%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.80%	5.20%	0.00%	0.00%	NA
Indica II	465	95.50%	4.10%	0.00%	0.43%	NA
Indica III	913	69.40%	29.90%	0.11%	0.55%	NA
Indica Intermediate	786	72.60%	26.80%	0.00%	0.51%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134962845	G -> A	LOC_Os01g60440.1	upstream_gene_variant ; 3490.0bp to feature; MODIFIER	silent_mutation	Average:72.671; most accessible tissue: Minghui63 flag leaf, score: 85.151	N	N	N	N
vg0134962845	G -> A	LOC_Os01g60460.1	downstream_gene_variant ; 1298.0bp to feature; MODIFIER	silent_mutation	Average:72.671; most accessible tissue: Minghui63 flag leaf, score: 85.151	N	N	N	N
vg0134962845	G -> A	LOC_Os01g60450.1	intron_variant ; MODIFIER	silent_mutation	Average:72.671; most accessible tissue: Minghui63 flag leaf, score: 85.151	N	N	N	N
vg0134962845	G -> DEL	N	N	silent_mutation	Average:72.671; most accessible tissue: Minghui63 flag leaf, score: 85.151	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134962845	NA	6.03E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962845	NA	1.37E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962845	NA	1.99E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962845	NA	4.52E-06	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962845	NA	3.36E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962845	NA	8.38E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962845	NA	3.36E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251