Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134962630:

Variant ID: vg0134962630 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34962630
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCTCCGCGATCGCCCACTCCATCGACCACAGCGTCGTCTCGATCGCTGCAAGCAACATGGTTAACGAAAATAAATTAAAAAGAAGAAGAAGAAACTGT[T/G]
AACTGAACCGAGGCACGCGTACCGGCAACATTGATGTTCTCGACAATGTAGAGCACGTTGTCCTCGTTGATCTCCCCCTTCTGCTGCGCCTCCAGGATGT

Reverse complement sequence

ACATCCTGGAGGCGCAGCAGAAGGGGGAGATCAACGAGGACAACGTGCTCTACATTGTCGAGAACATCAATGTTGCCGGTACGCGTGCCTCGGTTCAGTT[A/C]
ACAGTTTCTTCTTCTTCTTTTTAATTTATTTTCGTTAACCATGTTGCTTGCAGCGATCGAGACGACGCTGTGGTCGATGGAGTGGGCGATCGCGGAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	39.70%	0.02%	0.00%	NA
All Indica	2759	97.00%	2.90%	0.04%	0.00%	NA
All Japonica	1512	2.00%	98.00%	0.00%	0.00%	NA
Aus	269	36.10%	63.90%	0.00%	0.00%	NA
Indica I	595	95.10%	4.70%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	1.70%	98.30%	0.00%	0.00%	NA
Tropical Japonica	504	2.40%	97.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134962630	T -> G	LOC_Os01g60440.1	upstream_gene_variant ; 3275.0bp to feature; MODIFIER	silent_mutation	Average:72.906; most accessible tissue: Zhenshan97 flag leaf, score: 85.638	N	N	N	N
vg0134962630	T -> G	LOC_Os01g60460.1	downstream_gene_variant ; 1513.0bp to feature; MODIFIER	silent_mutation	Average:72.906; most accessible tissue: Zhenshan97 flag leaf, score: 85.638	N	N	N	N
vg0134962630	T -> G	LOC_Os01g60450.1	intron_variant ; MODIFIER	silent_mutation	Average:72.906; most accessible tissue: Zhenshan97 flag leaf, score: 85.638	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134962630	1.93E-07	NA	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	9.78E-08	NA	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	2.01E-21	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	5.97E-70	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	1.37E-19	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	2.21E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	6.10E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	1.15E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	7.50E-07	NA	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	1.55E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	2.72E-21	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	3.17E-57	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	6.82E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	1.67E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	1.95E-29	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	2.50E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	1.62E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962630	NA	3.38E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251