Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134962399:

Variant ID: vg0134962399 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34962399
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, G: 0.34, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGACGAGCACCTTGCTCTCGGCGGGGATGCCGTACCCGGCGAGCTCGGCGTCGCGGAGGTTCATGTGCGGCACCAGCAGCGGGATGGCCATGCGCAGCCG[G/C]
AGCGTCTCCTTGACCACGGCCTGCAGGTAGGGGAGCCTGTGCGTGTCCGGCTCCGTGATCTGACGCCCCGGGCCGAGCACCGTGTCCAGCTCCCGGCGCA

Reverse complement sequence

TGCGCCGGGAGCTGGACACGGTGCTCGGCCCGGGGCGTCAGATCACGGAGCCGGACACGCACAGGCTCCCCTACCTGCAGGCCGTGGTCAAGGAGACGCT[C/G]
CGGCTGCGCATGGCCATCCCGCTGCTGGTGCCGCACATGAACCTCCGCGACGCCGAGCTCGCCGGGTACGGCATCCCCGCCGAGAGCAAGGTGCTCGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.70% 0.02% 0.00% NA
All Indica  2759 97.00% 3.00% 0.04% 0.00% NA
All Japonica  1512 2.00% 98.00% 0.00% 0.00% NA
Aus  269 36.10% 63.90% 0.00% 0.00% NA
Indica I  595 95.10% 4.70% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134962399 G -> C LOC_Os01g60450.1 synonymous_variant ; p.Leu341Leu; LOW synonymous_codon Average:78.79; most accessible tissue: Zhenshan97 flag leaf, score: 90.685 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0134962399 G C -0.01 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134962399 1.42E-09 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 9.26E-10 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 3.74E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 2.44E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 5.21E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 2.99E-10 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 6.70E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 3.31E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 1.44E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 4.27E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 1.11E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 6.99E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 1.38E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 1.45E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134962399 NA 5.85E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251