\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134272325:

Variant ID: vg0134272325 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34272325
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAGGGGAATCCTCTAATAAGAATAGCGAGCCAGAGGGTGAGCAGAAGCAAGAAGGGATCAAGGCCTCCACTTCAGCTGTTCCTTTAAGTACAAGTCCC[T/G]
ACTGCCACTTCTGTGGGTCAGATGGACATTGGCAGAGAAATTGCACACGCTTCACAGCGTGGTTAGTCAAGAAAGGTATAAATGAAATTAAATAAATCCC

Reverse complement sequence

GGGATTTATTTAATTTCATTTATACCTTTCTTGACTAACCACGCTGTGAAGCGTGTGCAATTTCTCTGCCAATGTCCATCTGACCCACAGAAGTGGCAGT[A/C]
GGGACTTGTACTTAAAGGAACAGCTGAAGTGGAGGCCTTGATCCCTTCTTGCTTCTGCTCACCCTCTGGCTCGCTATTCTTATTAGAGGATTCCCCTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 5.20% 1.08% 0.36% NA
All Indica  2759 98.10% 1.20% 0.40% 0.25% NA
All Japonica  1512 83.20% 13.60% 2.65% 0.53% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.60% 2.70% 0.34% 0.34% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 1.80% 1.15% 0.64% NA
Temperate Japonica  767 69.80% 24.10% 5.22% 0.91% NA
Tropical Japonica  504 97.80% 2.00% 0.00% 0.20% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134272325 T -> G LOC_Os01g59280.1 missense_variant ; p.Tyr287Asp; MODERATE nonsynonymous_codon ; Y287D Average:27.473; most accessible tissue: Zhenshan97 flower, score: 39.624 unknown unknown TOLERATED 0.08
vg0134272325 T -> DEL LOC_Os01g59280.1 N frameshift_variant Average:27.473; most accessible tissue: Zhenshan97 flower, score: 39.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134272325 NA 5.95E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 NA 6.22E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 2.71E-09 1.03E-15 mr1182 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 3.03E-07 1.99E-10 mr1182 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 1.78E-08 8.18E-14 mr1282 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 1.64E-07 6.76E-10 mr1282 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 1.38E-09 2.42E-15 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 3.37E-08 2.23E-10 mr1650 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 3.86E-08 8.65E-13 mr1658 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 1.42E-07 1.42E-09 mr1658 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 NA 2.95E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 NA 3.57E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 3.69E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 NA 1.69E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 NA 1.26E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 3.28E-08 5.20E-16 mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 NA 1.48E-09 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 3.21E-07 7.43E-13 mr1282_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 NA 3.53E-08 mr1282_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134272325 NA 6.27E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251